Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
Hey there,
Scientists ensure the validity by sharing results with others to make sure they get the same results. They also conduct the expiremnt more than once.
Hope I helped :)
You can tell the difference by the amount of hydrogen in the chemical equation. You can tell by the second one that there is H2, which means there are 2 hydrogens in NADPH2 while NADPH only has 1 hydrogen
Answer:
Blood ----> Increased Glucose Concentration ------> pancreatic beta cells------> Insulin Released -----> Muscle and Other Tissues ---- Increased glucose uptake------- increased glycogen synthesis------ decreased glycogen breakdown------ -------> Adipocytes ------> increased triacylglycerol synthesis