1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren [92.7K]
3 years ago
8

There are more hydrogen atoms in living organisms than any other atom, but oxygen is more abundant in terms of mass.

Biology
2 answers:
Mariana [72]3 years ago
8 0

The right answer is B.

*Hydrogen is the most abundant element representing nearly three quarters of the mass of the universe.

*Hydrogen is found in the water that covers 70% of the surface of our planet as well as in all organic matter.

*Hydrogen is the simplest element in the universe. It is composed only of one proton (p) and only one electron (e-).

*Hydrogen is the lightest element of all elements and gases; it is 14 times lighter than air. A "spill" of hydrogen gas immediately diffuses into the air and pollutes neither the ground nor the water table.

*Hydrogen is invisible, odorless and nontoxic. It does not cause acid rain, does not deplete the ozone layer and does not generate dangerous emissions.

navik [9.2K]3 years ago
6 0
Hydrogen has a much much smaller mass.  Oxygen is like 16 times more dense.  
You might be interested in
What is the mRNA transcript if the complementary DNA is TCTGAG?
Ghella [55]

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

3 0
2 years ago
How do scientists ensure the validity of their conclusions when performing an experiment?
velikii [3]
Hey there,

Scientists ensure the validity by sharing results with others to make sure they get the same results. They also conduct the expiremnt more than once.

Hope I helped :)
8 0
3 years ago
I will mark brainiest for correct answer
IrinaK [193]

Answer:

b is correct

Explanation:

3 0
3 years ago
Read 2 more answers
Difference between NADPH and NADPH2?
zalisa [80]
You can tell the difference by the amount of hydrogen in the chemical equation. You can tell by the second one that there is H2, which means there are 2 hydrogens in NADPH2 while NADPH only has 1 hydrogen
8 0
3 years ago
The hormone insulin regulates glucose concentration in the blood through metabolic changes. Complete the flowchart below by movi
gizmo_the_mogwai [7]

Answer:

Blood ----> Increased Glucose Concentration ------> pancreatic beta cells------> Insulin Released -----> Muscle and Other Tissues ---- Increased glucose uptake------- increased glycogen synthesis------  decreased glycogen breakdown------ -------> Adipocytes ------>  increased triacylglycerol synthesis

4 0
3 years ago
Read 2 more answers
Other questions:
  • Homeostasis is a combination of ___?____ processes responding to stimuli.
    7·2 answers
  • Why can some fossils form in cold temperatures
    8·2 answers
  • The difference in the ____ of P waves and 5 waves is used to locatean eartquaker’s epicanter.
    11·1 answer
  • ^30 POINTS^
    8·1 answer
  • How do the circulatory and endocrine systems work together?
    7·2 answers
  • A team of scientists is studying several plant species that they think could become new farm crops. The scientists want to apply
    14·2 answers
  • Which is the significance of the tunica in plant growth? HINT: It's not B.
    14·1 answer
  • !!!!PLEASE HelP!!!!
    13·2 answers
  • Humans blood's pH is 7.4. What kind of drinks are safe for us? A. Highly acidic B. Neutral or close to neutral C. Highly basic D
    7·1 answer
  • In a human body
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!