1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergeeva-Olga [200]
3 years ago
12

Can you use different gender urine if on period for drug test

Biology
1 answer:
Lelu [443]3 years ago
3 0
No because that would not be your urine 
You might be interested in
What is found in every organ
IgorLugansk [536]
Tissue is the answer you are looking for
3 0
4 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Making ATP without using oxygen is called
Lilit [14]
Anaerobic means with out oxygen
8 0
3 years ago
How does the cardiovascular system and respiratory system provide oxygen to cells ?
Ymorist [56]

Answer:

The respiratory system works directly with the circulatory system to provide oxygen to the body. Oxygen taken in from the respiratory system moves into blood vessels that then circulate oxygen-rich blood to tissues and cells.

3 0
3 years ago
Sparrows produce an average of 5 eggs in each clutch. If there are more than 5. Parents can't adequately feed the young. if ther
Elina [12.6K]

Answer:  it would be natural selection

Explanation:

8 0
3 years ago
Other questions:
  • It is believed that the coelacanths and lungfish (lobed fin fishes) represent a crucial link between other fishes and tetrapods.
    15·1 answer
  • Which of the following is not a typical source of chemical weathering?
    8·1 answer
  • Imagine that you are studying a newly discovered bacterium from a hot springs in Yellowstone National Park. When you examine the
    6·1 answer
  • What is ment by paranoid​
    12·2 answers
  • Oxygen was into ally created in earths atmosphere by___.
    8·2 answers
  • 3) Scientists who have examined the fossil record have noted that some species have changed very little over long
    7·1 answer
  • I am made of many cells. My cells have an organized nucleus. I have two parents and eat only meat. Who am I?
    11·1 answer
  • 1 point
    11·1 answer
  • What was known before Franklin and Wilkins conducted their studies of DNA? Select three options.
    14·1 answer
  • Cuales son los principios activos de la menta?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!