Examples of abiotic factors are water, air, soil, sunlight, and minerals.Biotic factors are living or once-living organisms in the ecosystem.
Biotic describes a living component of an ecosystem; for example organisms, such as plants and animals.
Examples Water, light, wind, soil, humidity, minerals, gases.
<u><em>Hope this helps!</em></u>
Write a new hypothesis and conduct new experiments to explore the matter. Thus, option "B" is correct.
<h3 /><h3>What is the Hypothesis?</h3>
Hypothesis
The formulation of hypotheses is one of the key steps in the scientific method.
Hypotheses are usually tested using experiments and are usually accepted or rejected depending on the outcome of the experiments.
If a hypothesis is rejected, it does not mean that the entire subject is abandoned. Rather, new hypotheses may be formed and experiments conducted to further explore the subject.
More hypotheses can be found here:
brainly.com/question/23056080
#SPJ1
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
Chemical bonds contain potential energy.
Explanation:
Chemical bonds always contain potential energy. The atoms of the bond want to move to a lower energy to become more stable.. The energy for breaking bonds only comes when stronger bonds are formed. This energy is used to tear apart the bonds holding the Hydrogen atoms together. The strength of the covalent bonds depend on the overlap between the valence orbitals of the bonded Atom.
1.An open mind
2.Curiosity
3.Flexibility
4.Creativity
5.Patience and
6.Observation skills
