1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sveticcg [70]
4 years ago
7

Multiple choice biology question need help ASAP

Biology
2 answers:
Tatiana [17]4 years ago
6 0
The answer is C, hope I helped (:
zubka84 [21]4 years ago
4 0
I think the answer is c plz tell me if i am wrong

You might be interested in
How many positive particles does zinc have? *
GREYUIT [131]

Answer:

30 electrons

30 protons

34 neutrons

5 0
2 years ago
Describe the function of each organelle.Chloroplasts and Centrioles
andrew11 [14]

chloroplast has a function in food production based photosynthesis. it receives light and c02 and produce glucose and water.

centrioles are the key factors in cell division. the create poles when a cell divides in two cells. many others activities are performed by them.

7 0
4 years ago
True or False organisms need nitrogen for carbohydrates?
Blizzard [7]

Answer: true

Explanation:

4 0
3 years ago
Consider the following mRNA strand: CCAUGGCAAAGGAGUGACUAA
Nitella [24]

Answer:

If it helps, I only know the mRNA to DNA conversion:

GGT CCG TTT CCT CCT GTT

Explanation:

3 0
3 years ago
How can diversity be determined by the environment?
slavikrds [6]

Answer:

Emy if you are new here let me tell you u can't a descriptive questionnn for 10 points u need to shoot it to 100

7 0
3 years ago
Read 2 more answers
Other questions:
  • Describe pioneer species. What types of environments do they like?
    8·1 answer
  • Which of the following are examples of nucleic acids?
    8·1 answer
  • Pick the statement that’s INCORRECT.
    12·1 answer
  • Why was the appearance of blue algae Significant​
    5·1 answer
  • PLEASE HELP, I need help on this assignment
    8·1 answer
  • How does bacteria become immune to antibiotics? (short answer)
    15·1 answer
  • does the rate of alcoholic fermentation differ when different types of sugar are used as a source of energy! i need a claim n ev
    8·1 answer
  • Which of the following is not made of DNA?
    15·1 answer
  • Plss help me asap!!!!!​
    12·1 answer
  • The moon is made of rocks and dirt
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!