Answer:
1) density "the degree of compactness of a substance."
2) air masses "More dense, or “heavier” air will slow down objects moving through it more because the object has to, in effect, shove aside more or heavier molecules. Such air resistance is called “drag,” which increases with air density."
Explanation:
BRAINLIEST? plz
Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
Answer:
: Notice the rate of diffusion increases as the concentration gradient increases. If the concentration of molecules outside the cell is very high relative to the internal cell concentration, the rate of diffusion will also be high.
