1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marissa [1.9K]
3 years ago
13

5+5=A- 10B- 31C- 7D- 20 

Biology
2 answers:
natita [175]3 years ago
6 0
Five plus five equals ten.
erma4kov [3.2K]3 years ago
4 0
A- 10. I have absolutely no clue why you’re asking this question....plus you asked it in the Biology section...well, here’s your answer
You might be interested in
12) What is one question you have about the study of life? Remember that a good scientific question is concise, clear, and verif
arsen [322]

Answer:IDKKK

Explanation:IDKKKKKKKKKK

8 0
4 years ago
What is meant by the term "density"? Please provide an example of how
WARRIOR [948]

Answer:

1) density "the degree of compactness of a substance."

2) air masses "More dense, or “heavier” air will slow down objects moving through it more because the object has to, in effect, shove aside more or heavier molecules. Such air resistance is called “drag,” which increases with air density."

Explanation:

BRAINLIEST? plz

7 0
3 years ago
What is the mRNA transcript if the complementary DNA is TCTGAG?
Ghella [55]

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

3 0
2 years ago
Describe the biodiversity in the lion king movie
gizmo_the_mogwai [7]

Answer: never watched it

Explanation:

8 0
3 years ago
In which condition the substrate have faster diffusion rate
Sonja [21]

Answer:

: Notice the rate of diffusion increases as the concentration gradient increases. If the concentration of molecules outside the cell is very high relative to the internal cell concentration, the rate of diffusion will also be high.

8 0
4 years ago
Other questions:
  • What are the organs of a frog? and i need friends
    11·2 answers
  • Which term describes a pattern in which rapid changes occur in a species for short period, followed by a long period of little o
    7·1 answer
  • 4. If index of refraction 1 is 1.5, index of refraction 2 is 2.0, and the angle of incidence is 45 degrees, what is the angle of
    5·1 answer
  • Why does adenine always pair with thymine and guanine always pair with cytosine? What two factors determine the base pairing rul
    11·2 answers
  • Under which of the below conditions will natural selection be least likely to result in adaptation?
    12·1 answer
  • Definition: This is the process of matter changing from the liquid to the solid state.
    11·2 answers
  • What laws did the government pass to protect our environment?​
    8·1 answer
  • Without evaporation, the water cycle would not be able to continue to repeat over and over again.
    11·1 answer
  • How can accidental transfer of DNA impact a crime scene investigation? In addition, explain why accidental DNA transfer cannot b
    11·1 answer
  • The picture below shows a large rock and a container of water. The rock and the water have the same mass and temperature.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!