1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lera25 [3.4K]
3 years ago
7

A biologist marked a cell that he knew was about to undergo meiosis. A short time later he observed the four cells produced by t

he original marked cell, their chromosome numbers were 17, 17, 18, 16. He knew these numbers indicate that something abnormal had occurred during meiosis.
Biology
1 answer:
melomori [17]3 years ago
8 0

Answer:

NON DISJUNCTION: when 2 homologous chromosomes move to the same pole during meiosis. One daughter cell will be missing one chromosome while the other will have an extra chromosome.

Explanation:

You might be interested in
What does a heterotroph mean?
Lelu [443]

Answer:

An animal that cannot make its own food.

Explanation:

A heterotroph is an animal or life source that cannot make its own food, so it depends on others things, such as plants or other animals. These types of listings can be as followed :

Carnivores

Herbivores

Omnivores

7 0
3 years ago
Help i dont understand please
Zolol [24]
Graph c is the only graph that shows a growth curve and a carrying capacity so it is graph c
8 0
3 years ago
Read 2 more answers
chrosomes are found insise the______ of a cell. They are ______ pairs of chromosomes in every human body cell. One of each pair
RoseWind [281]

Answer:

23 pairs nucleus parents and dna

i know that the 23 pairs is right and i also think that the rest is right to

5 0
3 years ago
TRNA molecules deliver amino acids to ribosomes where the amino acid next
lesantik [10]

Answer:

tRNA molecules deliver amino acids to ribosomes where the amino acid next becomes an anticodon (option C).

Explanation:

A tRNA molecule is able to deliver amino acids to the ribosomes for protein synthesis, forming an anticodon that complements the codon of the mRNA being translated. The mRNA molecules are responsible for conducting the genetic code —obtained from DNA transcription— to be translated by the ribosomes. This code is established by sequences of three nucleotides, called codons, which encode different amino acids.

What happens when mRNA molecules expose codons to ribosomes is that a tRNA molecule containing a complementary anticodon is formed, which is conducted to the ribosome to bind to the codon. This allows, according to the genetic code, the formation of a protein with a specific sequence of amino acids.

6 0
2 years ago
Francis was recording plant heights for an experiment. Each time that she took a measurement, she wrote it down. Then, she measu
sweet-ann [11.9K]

Answer:

she was trying to find the definite height of the plant

8 0
3 years ago
Read 2 more answers
Other questions:
  • This is some barrier to reproduction among a species of organisms. It often results in genetic change over time and the developm
    6·2 answers
  • A current federal program from the New Deal that is directly related to the banking industry is the
    6·2 answers
  • Piper touches a block of ice, and she feels that it is very cold. How does she feel the sensation of cold?
    7·1 answer
  • Bioremediation is _____. a. the modification of prokaryotes for industrial purposes b. the use of prokaryotes in producing pharm
    14·1 answer
  • A dog breeder mates a homozygous brown dog (BB) with a homozygous white dog (bb) and all of the puppies are brown (Bb). These pu
    6·2 answers
  • Many polysaccharides are used for short term energy storage. Which carbohydrate is used for energy storage in the liver?
    6·2 answers
  • Anyone wanna ta.lk to me bc i bo..red
    11·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • 20
    5·1 answer
  • Short notes on dispersal of seed
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!