1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cluponka [151]
3 years ago
10

Someone help me i don’t understand:)

Biology
1 answer:
borishaifa [10]3 years ago
6 0

Answer:

A:inside the cell is 10%

B:the water outside the cell is 90%

C:Yes osmosis occur

You might be interested in
Which cell organelle uses oxygen to produce energy for the cell to use for life ?
pentagon [3]

The mitochondria is the site of respiration and energy production.

5 0
3 years ago
Which statement correctly uses the model to explain how mitosis maintains genetic continuity ?
maksim [4K]

Answer:

Develop and use models to explain the role of cellular reproduction (including binary fission, mitosis, and ... 1 2 3 4 5 6 7 Which statement correctly uses the model to explain how mitosis maintains genetic continuity?

Explanation:

Develop and use models to explain the role of cellular reproduction (including binary fission, mitosis, and ... 1 2 3 4 5 6 7 Which statement correctly uses the model to explain how mitosis maintains genetic continuity?

7 0
3 years ago
Look at the levels of carbon dioxide in the data table below.
alex41 [277]
<span>the correct answer is a.)317 ppm</span><span>
</span>
6 0
3 years ago
Read 2 more answers
How are DNA and RNA different in terms of function, # strands, and sugars?
goldenfox [79]

DNA is double-stranded while RNA is single stranded.  DNA contains thymine base whereas RNA contains uracil base.  RNA contains a ribose sugar while DNA contains a deoxyribose sugar.  The function of DNA is long term storage of generic info.  The function of RNA is for translating and transferring genetic code from the DNA to ribosomes to create proteins.

7 0
3 years ago
What are the possible genotypes and phenotypes of the offspring: both parents have achondroplasia (they are heterozygous) and ar
Phantasy [73]

Answer: njnjnjnjinjinjnjinjinjnjnjnjnjnj

4 0
3 years ago
Other questions:
  • Which of the following is the best example of a community?
    9·2 answers
  • A cell is most likely an animal cell because
    10·1 answer
  • What would happen to a eukaryotic cell if too much osmotic pressure develops within a cell?
    10·1 answer
  • Your father has type b blood. your mother has type o blood. you get tested and learn that your blood is also type o. what does t
    6·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • The elements in a compound are in a fixed proportion. What does this mean?
    8·1 answer
  • The nurse is completing a sexual history on a client. the client reports a history of having a sexually transmitted infection (s
    13·2 answers
  • Drag each tile to the correct location on the chart.
    11·1 answer
  • How much dna is in each nucleus of each cell
    11·2 answers
  • The answer is 588m^2
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!