1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natima [27]
3 years ago
14

Which are potential sources of error in the experiment? Check all that apply. estimating temperature to the nearest tenth of a d

egree
estimating the mass of the sample to the nearest tenth of a gram
estimating the thickness of the foam cups
the position of the cups of sand and water under the heat lamp
the brand of light bulb used for the heat lamp the air temperature outside the lab
Biology
2 answers:
Dafna11 [192]3 years ago
7 0

The correct option are as follows:

estimating temperature to the nearest tenth of a degree

estimating the mass of the sample to the nearest tenth of a gram

the position of the cups of sand and water under the heat lamp

<u>Explanation:</u>

Error is an uncertainty or the amount of deviation in a physical quantity. There may arise some deviance while measuring physical quantity due to approximation.

Instrumental, environmental, procedural, and human are some of the common sources of error. The error can be classified into two types:

i) Random error

ii) Systematic error

Types of error are determined based on the deviation in the result. While observing the temperature of something, the temperature should be noted to the nearest tenth of a degree. In similar way, the mass of the sample should be estimated to the nearest tenth of a gram.

ad-work [718]3 years ago
7 0

Answer:

<u>estimating temperature to the nearest tenth of a degree</u>

<u>estimating the mass of the sample to the nearest tenth of a gram</u>

<u>the position of the cups of sand and water under the heat lamp</u>

Explanation:

Those are correct i just did the question

Hope this helps!

You might be interested in
PLEASE ANSWER QUICK!!!!!!!!!!!!!! A building has different types of openings, such as windows and doors. Do you think a cell als
RSB [31]

Answer:

Yes

Explanation:

Just like a building which has different types of openings, so does a cell. These openings also have many different functions just like an opening in a building. A window is an opening which has a function just like a cell. Different openings have different functions.

7 0
4 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
If an object has a mass of 10 kg on Earth, what would be its mass on a planet with half the gravity of Earth?
Natali [406]

Answer:5 kg

Explanation:

7 0
3 years ago
Read 2 more answers
Which organic molecules serve as a catalyst in chemical reactions? O lipids O proteins onucleic acids carbohydrates​
Angelina_Jolie [31]

Answer:

Proteins

Explanation:

7 0
3 years ago
What are examples of devices that use electromagnetic waves? Check all that apply.
kiruha [24]

Answer:

FM radios and TV remote controls.

6 0
3 years ago
Other questions:
  • What kinds of information would help a community distant from the coast commit to preserving a barrier island
    7·1 answer
  • The Viceroy butterfly is not poisonous but has coloration that is almost identical to the poison monarch butterfly. Which type o
    8·2 answers
  • Who can help me ? ??
    6·1 answer
  • Why do hurricanes change direction at 30 degrees North latitude?
    12·1 answer
  • Why would water stop soaking into the ground in the saturated zone?
    15·1 answer
  • Why are some motors painted black?
    8·1 answer
  • Which of the following correctly compares the changes that take place in an ecosystem during primary succession and secondary su
    15·2 answers
  • What are two ways in which waves erode the land?
    6·1 answer
  • A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statement
    7·1 answer
  • If a person is suffering from severe dehydration and does not have enough water in his or her cells, a physician might give the
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!