1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mrs_skeptik [129]
3 years ago
6

MRNA is involved in the process of protein synthesis Group of answer choices

Biology
1 answer:
zheka24 [161]3 years ago
7 0

Answer:

to copy the DNA code from the nucleus of the cell and take it to the cytoplasm.

Explanation:

mRNA is messenger RNA which is transcribed inside nucleus and leaves the nucleus to enter cytoplasm where it is used as a blueprint to make a protein.

You might be interested in
During the replication process, which enzyme(s) unwind(s) the double-stranded DNA?
zavuch27 [327]

Answer:

DNA polymerase

Explanation:

I learned about this before and I believe that this is the answer.

8 0
3 years ago
A body of fresh water is shown below.
Triss [41]

Answer:

Point D

Explanation:

Point D is the point that is most likely to not have any plants growing in it. The reason why this point of the body of water will not have any plants is because of the lack of light. This part of the body of water is dark, with no light penetrating to it. The plants need light to survive, as it is a vital element in the process of photosynthesis. If there isn't any light, the plants can not perform photosynthesis, thus they can not produce their own food, which in turn means that they will not exist in such a place.

6 0
3 years ago
Read 2 more answers
The peripheral nervous system includes the
Tpy6a [65]

Answer:

C) Autonomic Nervous System .

Explanation:

3 0
4 years ago
PLEASE HELP <br> Where is the DNA located within the cell?
bogdanovich [222]
Most DNA is located in the cell nucleus (where it is called nuclear DNA), but a small amount of DNA can also be found in the mitochondria (where it is called mitochondrial DNA or mtDNA).
6 0
3 years ago
What general processes and characteristics make the phospoerous and sulfer cycle similar ?
Ivenika [448]

Answer:

Both exist in rocks and soils and are naturally released slowly by

weathering over time

Explanation:

8 0
3 years ago
Other questions:
  • What name is assigned to aug, which stands for methionine with which all mrna molecules start?
    6·1 answer
  • Name the bacteria food in root nodules of leguminous plant​
    7·1 answer
  • What is the result when DNA ligase has completed its job?
    8·2 answers
  • The highest tier in cell hierarchy is _____.<br><br> cell<br> organ<br> tissue<br> organ system
    12·2 answers
  • Identify the type of chemical reaction. H2SO4 + 2KOHK2SO4 + 2H2O
    15·1 answer
  • Match the term with the definition. Match Term. Definition Condensation A) A phase change from a solid to a gas Evaporation B) A
    5·2 answers
  • true or false? Rewrite the false statements to make them true: With hypophosphatemia, all daughters of affected males will show
    12·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • The cactus wren bird
    8·1 answer
  • The concept presented to explain the origin of eukaryotic cells, namely that a bacterial cell parasitized another descendant cel
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!