Tracheoesophageal fistula
Tracheoesophageal fistula (TE) is
a condition in which an abnormal channel (fistula) connects the trachea to the
oesophagus. It is a birth defect and is characterized by extensive salivation
with choking, vomiting and cyanosis during feeding. When eating, food
substances move through abnormal connection and this can cause other illnesses.
From the question given above, Morgan is likely have tracheoesophageal fistula.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
the ability to reproduce.
Jellyfish are forever but fish ain't.
Plus, jellyfish have those tentacle like things attached to thier body and you might confuse em for octopus for that very reason..
but you should really evade confusing em as an octopus cuz octopus might take it as an insult and the next thing you know will be a Kraken taking your house down.. which is pretty tragic :'(
We can help you send a question
