1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
3 years ago
8

The cladogram shows relationships among several mammal species which group of modern mammals is the most likely closely related

to elephants
Biology
1 answer:
Y_Kistochka [10]3 years ago
7 0
A Rock Hyrax or Rock Rabbit are closely related to elephants As will as Dugong which a species of manatees 
You might be interested in
What are the raw materials of water?
LuckyWell [14K]
There are different materials of raw water, but also the raw water comes from ponds,rivers, and oceans but they might be good sometimes, and gas not been treated and has bacteria or mold buy that is not good.
6 0
3 years ago
Read 2 more answers
If your temporal lobe was damaged, what might happen to you?
nikklg [1K]

Answer:

c you would have trouble remembering things.

Explanation:

Difficulty learning and retaining new information. Impaired factual and long-term memory, Persistent talking, Difficulty in recognizing faces.

7 0
2 years ago
Is there a difference between plants and animal requirements for energy?
kotykmax [81]
Yes. Plants use chemical energy to eat and gain energy. Animals mostly get energy from sleeping, and eating
6 0
2 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Africa is a continent split in half by the equator. Which climate zone is it mostly located in?
adelina 88 [10]
Tropical climate zone
3 0
3 years ago
Read 2 more answers
Other questions:
  • How could something as complex as the human eye or the octopus eye have evolved by natural selection?
    13·1 answer
  • Cells having matched pairs of chromosomes are
    12·1 answer
  • Which is the relationship between plants and oxygen?
    12·2 answers
  • Polygenic means that most traits are controlled by ________.
    6·1 answer
  • Arbon dioxide is not considered an organic molecule. Photosynthetic organisms turn it into an organic molecule in the form of a(
    13·1 answer
  • Select all the correct answers.
    9·1 answer
  • Why do scientists study galaxies
    8·2 answers
  • If you know the genotypes of the parents, what can you use to determine the possible genotypes of the offspring
    6·2 answers
  • PLZ HELP ILL GIVE U BRAINLYIST(science)
    14·1 answer
  • In a food chain the flow of energy is Always___.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!