Pi and sigma bonds
Pi is double bonds and sigma is single bonds
Since it has 4 protons, it must have an atomic number of 4. (That makes it beryllium.)
Since it has a 4 protons and 5 neutrons, it has a mass number of 9.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
In this scenario,I guess the answer is roughly around 300 children die every year from the diseases in which the vaccinations are available. Hope this is the correct answer then and would surely be of big help to you then.
Math 32 wolf CER gin EDJI AICE week 1