1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harina [27]
3 years ago
15

What is biology? what is the scientific method?

Biology
1 answer:
Zanzabum3 years ago
3 0

Answer:

Biology is the study of living things.

The scientific method is a method of procedure that has characterized natural science.

Explanation:

You might be interested in
Organic compounds contain what type of bonds
abruzzese [7]
Pi and sigma bonds
Pi is double bonds and sigma is single bonds
7 0
3 years ago
Read 2 more answers
What is the Atomic Number of a neutral atom that has 5 neutrons and 4 electrons
dexar [7]
Since it has 4 protons, it must have an atomic number of 4. (That makes it beryllium.)
Since it has a 4 protons and 5 neutrons, it has a mass number of 9.
5 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Worldwide, how many children die each year from diseases for which vaccinations are available?
Papessa [141]
In this scenario,I guess the answer is roughly around 300 children die every year from the diseases in which the vaccinations are available. Hope this is the correct answer then and would surely be of big help to you then.
7 0
3 years ago
Gin Edji | AICE Week 1 r...<br> - Wolf CER
Elden [556K]
Math 32 wolf CER gin EDJI AICE week 1
4 0
3 years ago
Other questions:
  • How can I change in scientific technology affect scientific how can I change in scientific technology affect scientific knowledg
    5·1 answer
  • Why do some life activities strengthen the substrate while others weaken it?
    10·1 answer
  • 3. In a watershed system, the two main parts are the
    5·1 answer
  • 3. List two behavioral adaptations that Darwin observed<br><br> PLZ HELP FAST
    13·1 answer
  • 15. DNA replication is said to be semi-conservative. What does that mean?
    6·1 answer
  • In what age did the T Rex exist
    15·2 answers
  • The _______ two objects are to each other, the stronger the force of gravity is between them.
    12·1 answer
  • This class of medicines relieves coughing.
    9·1 answer
  • What is the probability that a child would inherit x-linked rececive allele from his father
    10·1 answer
  • Mucus that protects your stomach lining is secreted by which type of epithelial cell?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!