1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANEK [815]
3 years ago
8

Which of the following infections could be treated by antibiotics?

Biology
1 answer:
julsineya [31]3 years ago
4 0

Answer:

C)

Explanation:

Tetanus is typically treated with a variety of therapies and medications, such as: antibiotics such as penicillin to kill the bacteria in your system.

You might be interested in
What products of photosynthesis are the reactants of cell respriration?
Pani-rosa [81]
Oxygen and glucose are both products of photosynthesis and reactants in cellular respiration. Hope this helps!

8 0
3 years ago
HELP ! 50 POINTS !!
xxTIMURxx [149]

C

The "Nucleus" contains the genetic information of the cell in the form of deoxyribonucleic acid (DNA) or chromosomes and thus, controls cell growth and multiplication. It is also the site of DNA replication (formation of an identical copy of DNA).

While the "Golgi apparatus", or Golgi complex, functions as a factory in which proteins received from the ER are further processed and sorted for transport to their eventual destinations: lysosomes, the plasma membrane, or secretion.

8 0
2 years ago
What is the approximate hydronium ion concentration and hydroxide ion concentration in a cup of tea?
Natasha2012 [34]

The hydronium ion is an oxonium ion whose chemical formula is H3O + or H + (aq). It is found in the solid, gaseous or liquid state (protonation of a molecule of water).


The concentration of hydronium ion is directly linked to the pH of the tea (or any solution) by this equation.:

C° (hydronium) = 10^(-pH)


if the pH of the tea is 6 for example, than:

C° (hydronium) = 10^(-pH) = 10^(-6).

4 0
3 years ago
Read 2 more answers
What characteristic of the genetic code makes it possible for bacteria to make a human protein?
777dan777 [17]
Because of the way builds up in your body
3 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Other questions:
  • What are some of the possible consequences of mutations
    10·1 answer
  • Why do some birds have bright colors while others look more camouflaged
    13·1 answer
  • Explain how the muscular and skeletal systems work together within the body.
    5·1 answer
  • Why dont earth quakes count as severe weather
    8·1 answer
  • What is the water-soluble b vitamin that works with enzymes to produce energy in cells, and that is found in milk, meats, liver,
    15·1 answer
  • 2. Create a summary statement for why we all need to wear masks in school (and in<br> public).<br> T
    12·1 answer
  • Which of the following holds true for energy coupling? A. Energy is released in an exergonic reaction. B. Energy is transferred
    5·2 answers
  • WILL GIVE BRAINLEST Radon is a kind of _____.
    9·2 answers
  • Light energy is converted into this type of energy usable by all organisms
    6·1 answer
  • A lesion in the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!