1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stels [109]
2 years ago
11

A biologist wishes to take a useful gene found in penguins and introduce it into some bacterial cells. Her experimental procedur

e is given below.
Use a restriction enzyme to cut a gene out of the penguin DNA.
Use a restriction enzyme to cut open a plasmid.
Treat the plasmid with DNA ligase.
Treat the plasmid with DNA polymerase.
Introduce the plasmid into bacterial cells.

A step is missing. Where should it go in this procedure?

“Mix the desired gene and plasmid together” should go after step 5.
“Mix the desired gene and plasmid together” should go between steps 3 and 4.
“Mix the desired gene and plasmid together” should be the first step.
“Mix the desired gene and plasmid together” should go between steps 2 and 3.
Biology
1 answer:
Scilla [17]2 years ago
8 0

Answer:

The last one IM like 80% sure its the answer

Explanation:

You might be interested in
Which of the following helps to explain a connection between science and society?
Vilka [71]
Science can be used to address societal issues and to inform policies.


Hope this was helpful :)
8 0
3 years ago
Read 2 more answers
If the rna molecule in a human has the nucleotide sequence of guu, this would indicate that the amino acid valine would be neede
Savatey [412]

there would be no change; GUU always codes for valine.

7 0
3 years ago
Read 2 more answers
In which group is parthenogenesis a normal event?
bezimeni [28]

Answer:

Bees

Explanation:

Parthenogenesis is a method of asexual reproduction in which an egg cell develops into a new individual without fertilization. Parthenogenesis occurs in insects, amphibians, reptiles, fish, and in some plants. Most of the organisms which reproduces through parthenogenesis, they also reproduce sexually. Parthenogenesis may be occurs by apomixis and by automixis. In apomixis, egg is produced by mitosis and results into diploid clones. In automixis egg is produced by meiosis and the haploid egg develops into diploid new individual by the duplication of chromosomes. Parthenogenesis is an adaptation which allows to reproduce in adverse environmental conditions when sexual reproduction is not possible.  

5 0
3 years ago
What combines with sugar and a phosphate group to form a nucleotide
-Dominant- [34]
Nitrogen Containing Base. It can be either Adenine, Guanine, Thymine, Cytosine, Uracil 
4 0
3 years ago
A scientific theory states that the universe is expanding. Which of these statements is correct about this theory?
Yakvenalex [24]
The answer would be : <span>It is a well supported explanation which cannot become a law.

A law and a theory are different you know. In fact, the law is universel. This applies for everything unlike a theory which explains in particular why something is happening.

Any doubts ?

Hope this helps !

Photon
</span>
6 0
3 years ago
Other questions:
  • What is the probable result of infusing mismatched blood
    11·1 answer
  • Which of these substances is a compound?
    9·2 answers
  • A toxicologist is taking samples trying to identify the specific poison involved in a sudden-death incident at a restaurant. Whe
    6·1 answer
  • Consider the two tide cycles seen here. We have drawn a red line from the crest of high tide to the trough of low tide. What doe
    10·1 answer
  • The human immune system can produce a specific response or a nonspecific response
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The substitution, addition, or removal of a single nucleotide in DNA is called a(n) ____________ mutation.
    10·2 answers
  • What type of association would you expect between a person's age and hair length?
    14·1 answer
  • How the layer of the earth connected and affected by each other
    7·1 answer
  • Limited resources on the galapagos islands result in?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!