1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flauer [41]
3 years ago
6

_____ use biology in their work. Dentists Dietitians Zoologists All of the above

Biology
2 answers:
statuscvo [17]3 years ago
8 0
Dentists need to know about the mouth and teeth. Thse involve learning about the human body, so is therefore a branch of biology.

Dietitions learn about the digestive system and is no doubt a branch of biology.

Zoology is the study of animals, and they are living creatures, meaning that this is a branch of biology.

Therefore, the answer to this multiple choice question is All of the Above
VikaD [51]3 years ago
6 0
I think the answer is all of the above......


dietitians -> need to learn about human body-> biology

zoologists-> need to learn about animals-> biology

so, since two answers are correct the answer is all of the above
You might be interested in
Guys! i need URGENT help!
zepelin [54]

Answer:

When carbon dioxide dissolves in seawater, the water becomes more acidic and the ocean’s pH (a measure of how acidic or basic the ocean is) drops. Even though the ocean is immense, enough carbon dioxide can have a major impact. In the past 200 years alone, ocean water has become 30 percent more acidic, faster than any known change in ocean chemistry in the last 50 million years.

Explanation:

7 0
3 years ago
When there is a lack of resources such as food, water, sunlight, shelter, and space this is often called
nignag [31]

Answer:

Limiting factors

Explanation:

6 0
1 year ago
Read 2 more answers
Plant growth is dependent on the amount of fertilizer applied. That was the hypothesis Mel and Bill decided on for their science
irinina [24]

The correct answer is C.

3 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Energy from the sun is transferred to the earth by
Scilla [17]

Answer: radiation i think

8 0
3 years ago
Other questions:
  • brainly why is it said that the sun provide either direct or indirect energy to all living things on earth
    7·1 answer
  • Which process in the light-dependent reactions results in the release of hydrogen ions, electrons, and oxygen? A) chemiosmosis B
    6·2 answers
  • An adolescent is admitted to the icu in diabetic ketoacidosis. the physician orders a continuous insulin infusion of 100u nph in
    6·1 answer
  • Index fossils are the remains of species that existed on Earth for relatively short periods of time. True or false?
    15·1 answer
  • What statement is true of all living organisms?
    10·1 answer
  • Mendel knew that the variations in the offspring
    12·1 answer
  • Each of the following is a function of the integumentary system except:
    6·1 answer
  • What do eukaryotes have that prokaryotes lack?
    12·2 answers
  • Which of the following is an example of genomic imprinting in humans? Which of the following is an example of genomic imprinting
    14·1 answer
  • How are cellular respiration and photosynthesis related, in terms of energy?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!