1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mekhanik [1.2K]
4 years ago
14

A solution that has the same osmotic concentration as a cells cytoplasms

Biology
1 answer:
katrin2010 [14]4 years ago
5 0

Answer:

isotonic

Explanation:

If the solute concentration of the cell and that of its surrounding medium are the same there will be no net flow of solvent in either directions. In this case the external solution is said to be isotonic to the cell since the osmotic pressure is the same.

You might be interested in
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
konstantin123 [22]
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.

This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3'  </span><span>the direction (--->)
3' ..</span>aatcg........................ 5'   the direction (<---)

adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).



3 0
3 years ago
If a cell has completed meiosis I and the first cytokinesis, and is just beginning meiosis II, which of the following is an appr
tangare [24]

Answer:

The options are missing in the question: They are,

A) It has half the amount of DNA as the cell that began meiosis.

B) It has half the chromosomes but twice the DNA of the originating cell.

C) It has one-fourth the DNA and one-half the chromosomes as the originating cell.

D) It is identical in content to another cell formed from the same meiosis I event.

The answer is A

Explanation:

Prior to undergoing any cell division including meiosis, the cell undergoes a phase called Interphase where it replicates its genetic material (DNA). The genetic material (DNA) content duplicates i.e. × 2 of the original number, during this phase. Each chromosome duplicates to form SISTER CHROMATIDS joined at the centromere.

Meiosis is the cell division that results in daughter cells with a reduced number of chromosomes (by half). It occurs in two distinct stages; Meiosis I and Meiosis II.

In meiosis I, homologous chromosomes (similar but non-identical chromosomes received from each parent) separates. Hence, the actual reduction in chromosomal number occurs here, this aslo affects the DNA content, as each divided cell i.e. after cytokinensis, now contains 1/2 of the DNA that started the actual meiotic division.

Here is how it works, each chromosome before DNA replication contains 1 DNA. Let's say the total chromosomes of the diploid organism (2n) is 46, hence, the organism at this stage contains 46 DNA. Each 46 chromosomes replicate to form 92 sister chromatids, which are still regarded as one chromosome each since each sister chromatids is linked at the centromere. Hence, we still have 46 chromosomes but the DNA content increases from 46 to 92, since each sister chromatid now contains one DNA.

Meiosis I occurs and homologous chromosomes separate. Hence each cell now has 23 chromosomes (46 sister chromatids) and 46 DNA i.e. 1/2 of the starting 92.

5 0
4 years ago
A scientist agrees with the scientific consensus that dinosaurs have scaly skin. Then he discovers a new fossil that indicates a
omeli [17]
The scientist who refuses to consider new evidence, assuming he or she is not biased or incompetent could do it because if there is a big amount of evidence indicating otherwise, this one new piece of evidence is unlikely and they prefer to wait for more evidence or for analysis of whether this current evidence is not false.

thus this scientist is being skeptical (practicing skepticism) by ignoring this new evidence.
6 0
4 years ago
Read 2 more answers
Prep What supplies energy in an
marusya05 [52]

Answer:

The answer would be <em>Electric</em><em> </em><em>cells</em><em>!</em><em> </em>

<em>Hope</em><em> </em><em>it</em><em> </em><em>helps</em><em>!</em><em> </em>

6 0
3 years ago
The miller-urey experiment was important because it showed __________.
mote1985 [20]
<span>The Miller-Urey experiment was one that produced several things, such as hydrogen cyanide, amino acids, adenine (among other nucleotides), and urea. The experiment proved that (c.) it was possible to form organic molecules from inorganic molecules. This explains why organic molecules were produced.</span>
8 0
3 years ago
Other questions:
  • Within the light organ, bacteria are protected and nourished, and rapidly increase in number. At night, they provide the light n
    5·1 answer
  • You decide to investigate if adding more enzyme will cause the reaction to proceed faster You set out to prove the
    14·1 answer
  • There Must be a sort of biological catalyst in order to react the raw materials together. what is the substance?
    6·1 answer
  • Bill is a professional photographer. His camera is broken and he needs a new one within the next hour or he will miss an importa
    7·1 answer
  • When does Rigor Mortis start? Is it permanent?
    8·1 answer
  • The analysis of rRNA gene sequences to compare evolutionary relationships is known as
    9·1 answer
  • The parenting style that can be described as lenient or inconsistent is called __________.
    15·1 answer
  • Which of the following take place in the
    7·2 answers
  • 2. Which mass of oxygen combines with 12 g of magnesium?(N04.18)
    5·1 answer
  • Approximately how many standard drinks can the human body metabolize in one hour?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!