1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blondinia [14]
3 years ago
13

What factor makes cattle susceptible to fright?

Biology
1 answer:
Tems11 [23]3 years ago
8 0
I would say D. poor spatial awareness because cattle can be easily startled by sudden movements or objects coming into their vision.
You might be interested in
From what you should now know about bacterial taxis and nodule formation, predict how a rhizobium would respond to a flavonoid.
andreev551 [17]

Answer;

-The bacterium would exhibit positive chemotaxis.

Explanation;

-Chemotaxis is the movement of cells or organisms in response to chemicals, whereby the cells are attracted (positive chemotaxis) or repelled (negative chemotaxis) by substances exhibiting chemical properties.

Flavonoids play a crucial role as signal molecules in promoting the formation of nodules by symbiotic bacteria commonly known as rhizobia. The roots of leguminous plants use positive chemotaxis to attract rhizobia. Flavonoids are the chemicals associated with attraction of Rhizobium bacteria.

6 0
3 years ago
Read 2 more answers
What happens when removing and organism from a food chain?
kondor19780726 [428]

Answer:

It depends on whether or not the organism is a producer or a predator. If the organism removed is a producer, every other organism that relies on said producer for food will not be able to survive. If the organism removed is a predator, the organisms that said predator eats will flourish, diminishing the natural resources in the ecosystem and inevitably starving the population of the ecosystem.

Explanation:

8 0
3 years ago
Gregor Mendel demonstrated that traits are passed from parents to offspring independently of one another under all circumstances
Angelina_Jolie [31]
Well from the statements is pronounced it is an observation. 
7 0
3 years ago
Read 2 more answers
Why is the term “fluid mosaic model used to describe the cell membrane
ratelena [41]

The Fluid Mosaic Model states that membranes are composed of a Phospholipid Bilayer with various protein molecules floating around within it. The 'Fluid' part represents how some parts of the membrane can move around freely, if they are not attached to other parts of the cell.

5 0
3 years ago
What does this information mean in terms of dating the mystery layer?
GalinKa [24]

Geologists can 'read' rock layers using relative and absolute dating techniques. ... Relative dating arranges geological events, and the rocks they leave behind, in a sequence. The method of reading the order is called stratigraphy (the rock layers are called strata).

3 0
2 years ago
Read 2 more answers
Other questions:
  • True or False: Wetlands and estuaries are critical ecosystems, but do not require protection.
    11·1 answer
  • What are the evolutionary advantages of organisms that can photosynthesize?
    13·1 answer
  • How do living things use each type of nucleic acid
    11·1 answer
  • Emily enjoys experimenting with color changing lizards. She places a green lizard on a brown background and a brown lizard on a
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Red-green color blindness is an X-linked recessive disorder that is passed through generations and can be traced by using a pedi
    15·2 answers
  • What is in a bacterial cell
    15·2 answers
  • Angela is curious about how Clomid works to stimulate her ovaries. Her doctor told her that this drug works by "tricking the bra
    12·1 answer
  • I NEED HELP ANSWER FAST
    13·1 answer
  • AHGCACHG-DNA
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!