Meiosis: cell division into four daughter cells (each has half the number of chromosome of the parent cell)
mitosis: cell division that results in two daughter cells (each has the same number and type of chromosomes as the parent cell)
Growth, repair, reproduce
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
