1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
3 years ago
9

The kidneys remove which cellular waste product from blood?

Biology
2 answers:
kumpel [21]3 years ago
5 0

The correct answer is C. urea

I tested this quiz to and that was the correct answer

Anna007 [38]3 years ago
3 0
<span> c. urea. Healthy kidneys filter the blood in our bodies. They remove waste materials like uric acid, urea and creatinine through urine. </span>Processes facilitated by kidneys such as regulating concentration and volume of body fluids help in maintaining homeostasis.
You might be interested in
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Mary and Tommy are measuring 10 grams of sugar on an electronic balance that measures to the hundredths of a gram. Tommy records
PolarNik [594]

<u>Answer:</u> The correct answer is Option C.

<u>Explanation:</u>

Precision refers to the closeness of two or more measurements to each other.

For Example: If you weigh a given substance five times and you get 3.2 kg each time. Then the measurement is very precise.  

Accuracy refers to the closeness of a measured value to a standard or known value.

For Example: If the mass of a substance is 32 kg and one person weighed 31 kg and another person weighed 29 kg. Then, the weight measured by first person is more accurate.

According to the question:

Mass weighed by Mary = 10.00 g

Mass weighed by Tommy = 10 g

As, mass weighed by Mary is reported upto 2 decimal places. Thus, it is more precise.

Hence, the correct answer is Option C.

6 0
3 years ago
reverse transcriptase is an enzyme found in association with retroviral activity. it has the property of ________.
Veronika [31]

Answer: synthesis of DNA from an RNA template

6 0
2 years ago
_________7. During strenuous exercise, skeletal muscles use up ___________ and produce large amount of ________, which causes pa
DanielleElmas [232]

Answer:

A. Oxygen, lactic acid

3 0
2 years ago
Which is NOT a characteristic of the
VLD [36.1K]
The answer is option a hope it helps
3 0
3 years ago
Other questions:
  • F. F. Blackman performed experiments to investigate the effects of various factors on photosynthesis. In one of his experiments,
    10·1 answer
  • Distinguish between directional, stabilizing, and disruptive selection. Give examples.
    6·1 answer
  • Images below show the skeleton of a monkey in the vertebrate or backbone of a human.
    13·1 answer
  • Which of the following is an IGNEOUS rock found in Pennsylvania? A. marble B. quartzite C. granite D. limestone
    11·1 answer
  • Precipitation is less likely to occur under
    6·1 answer
  • . Your lab technician was to determine the ash content of buttermilk by conventional dry ashing. The technician weighed 5 g of l
    9·1 answer
  • How does inorganic nitrogen from the atmosphere<br> (N2) get into living systems?
    8·1 answer
  • ¿Qué áreas del conocimiento me pueden <br> aportar a la ejecución del proyecto? para un huerto
    8·1 answer
  • Q6.7. During many epidemics, health-care professionals emphasize the importance of
    6·1 answer
  • During the loading of tbp, what event displaces the binding of tafs 11 and 13 from one of the stirrups of tbp?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!