1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zalisa [80]
2 years ago
5

reverse transcriptase is an enzyme found in association with retroviral activity. it has the property of ________.

Biology
1 answer:
Veronika [31]2 years ago
6 0

Answer: synthesis of DNA from an RNA template

You might be interested in
If a mutation occurred in SODD that prohibited its interaction with the DD of TNF receptor, the TNF receptor would
Xelga [282]

Answer: If a mutation occurred in Silencer of Death Domain (SODD) that prohibited its interaction with the DD of TNF receptor, the TNF receptor would evoke its response by binding to a transmembrane receptor, TNFR1.

Explanation: Binding to TNFR1 inhibits the recruitment of cytoplasmic signaling proteins to TNFR1 to prevent recruitment of a number of protein (TRADD) or prevent spontaneous aggregation of the cytoplasmic death domains of TNFR1 molecules.

SODD mechanism is useful in preventing unwarranted TNFR1 activation in the process of apoptosis.

3 0
3 years ago
How are biotic factors in the marine ecosystem responsible for bringing carbon-dioxide into the ocean?
Wewaii [24]

Answer:

Marine ecosystem have biotic organisms like phytoplankton and photosynthetic algae that do photosynthesis and converts the atmospheric carbon dioxide into organic matter most of the carbon dioxide is released when other organisms eat phytoplankton and release the carbon dioxide through respiration.

But some of the algae and phytoplanktons die naturally get down to the bottom of the ocean where they make carbon sink. Some organisms accumulate CO₂ in their exoskeleton that is made up of calcium carbonate.  

Therefore this use of carbon by living organisms in oceans brings carbon dioxide from the atmosphere to oceans. This is why the ocean plays a critical role in the carbon cycle and called carbon sink.

7 0
2 years ago
How does an atom become a positive ion?
gtnhenbr [62]

Answer:

The answer is C

Explanation:

Mark the brainly

5 0
2 years ago
Read 2 more answers
Both men and women conceived during the widespread famine of the Dutch Hunger Winter were more likely to be obese by age 5050 an
mixas84 [53]

Answer:

1. d. changes in the methylation patterns of <em>loci</em> involved in growth and metabolic disease

2. b. differences in the expression of metabolic genes

d. changes in histone acetylation patterns

Explanation:

Epigenetics refers to the study of heritable changes in gene expression which are not dependent on DNA sequence. Epigenetic mechanisms involve DNA methylation, histone modifications (acetylation, methylation, phosphorylation, etc) and regulatory non-coding RNA (ncRNA) pathways. These epigenetic mechanisms work together and mutually reinforce each other in order to modulate gene expression (either by activating or suppressing gene expression). In consequence, transcriptome data (e.g., genes differentially expressed in particular tissues/cells or stages of development) is an important piece of evidence indicating the existence of epigenetic modulation.

4 0
2 years ago
Which of the following is an example of a biochemical adaptation?
likoan [24]
Answer: Camouflage

Explanation: b
3 0
2 years ago
Read 2 more answers
Other questions:
  • How do plant get nutrients​
    6·2 answers
  • Infaniticide has been observed among several species of savanna baboons. in instances where a ‘bachelor' male takes over a harem
    15·2 answers
  • lupe is a carrier for color blindness. Her husband Clifford is colorblind. If lupe and clifford have four children, theoretical
    11·1 answer
  • Which of the following describes a relationship of predator-prey A. Oxpecker birds eat parasitic ticks off the backs of zebras B
    6·2 answers
  • An amoeba is a one-celled organism. The cell theory states that which of the following characteristics of amoebas must be true?
    9·1 answer
  • After tissue repair is completed, factor XII catalyzes the formation of a plasma enzyme called kallikrein, that in turn converts
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • How are the reactants represented in the chemical equation for photosynthesis?​
    5·1 answer
  • Please help in biology.
    9·1 answer
  • Can someone pls help me<br> WILL MARK U BRAINLIEST !!
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!