1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
3 years ago
7

sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT

Biology
1 answer:
Nonamiya [84]3 years ago
4 0

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

You might be interested in
1. Which biome is characterized by very low temperatures, little precipitation, and permafrost?
xxMikexx [17]
1) The biome that is characterized by low temperatures, permafrost, and little precipitation is the tundra. 

2) The latitude is the factor that explains why tundra biomes remain cold year round but taiga biomes have alternating warm and cold seasons. 

3) A couple of factors that explain the difference in biodiversity between the tundra and the tropical rain forest are warmer temps in rainforests allow more animals to live and higher than average rainfalls. 
8 0
3 years ago
Read 2 more answers
Why must scientists have good math skills? explain
Colt1911 [192]

Hello,


Answer: Here is what I could find!

Fortunately, exceptional mathematical fluency is required in only a few disciplines, such as particle physics, astrophysics and information theory. Far more important throughout the rest of science is the ability to form concepts, during which the researcher conjures images and processes by intuition.”


Best of Luck!


~

Your pal papaguy

4 0
3 years ago
In photosynthesis, carbon dioxide is reduced and h2o is oxidized. What type of chemical reaction is this?.
Vilka [71]

In photosynthesis, carbon dioxide is reduced and H₂O is oxidized. The type of chemical reaction is an oxidation-reduction reaction.

<h3 />

Explanation

Oxidation-reduction reaction are reactions that take place in electrochemical processes. Reduction is the reaction of decreasing oxidation number and increasing electrons and it can be said that reduction is the reaction of a substance losing oxygen. Oxidation is the reaction of increasing the oxidation number and decreasing electrons and can be said that oxidation is a reaction where the reaction of a substance binds oxygen.

Photosynthesis is one type of oxidation-reduction reaction that occurs naturally in everyday life. Photosynthesis has a complex process and involves green plants and certain bacteria. In the event of photosynthesis, carbon dioxide is reduced to carbohydrates and water is oxidized to oxygen.

The oxidation-reduction reaction in photosynthesis is:

6CO₂(g) + 6H₂O(l) + energy --> C₆H₁₂O₆(aq) + 6O₂(g)

Learn more about oxidation-reduction reaction on

  • brainly.com/question/13559667
  • brainly.com/question/16867778

#SPJ4

6 0
1 year ago
Jeremy has Parkinson’s disease, a progressive neurodegenerative disease that affects motor skills. In addition to motor symptoms
EastWind [94]

Answer:

It is likely that Jeremy’s<u> basal nuclei</u> is producing less <u>dopamine </u>than it needs to.

Explanation:

Parkinson's disease is caused by less production of neurotransmitter dopamine from basal nuclei present in the cerebrum of the brain. Lower levels of dopamine have caused Jeremy's mental health. He needs to smoke more than earlier to fight depression caused by lower dopamine levels.  

Dopamine imbalance would also affect his balance and coordination of muscles. He would not be able to perform the routine tasks by himself.  

5 0
4 years ago
What is the function of the seed producing?​
Nookie1986 [14]

Answer:

Function Seeds serve several functions for the plants

Explanation:

Functions. Seeds serve several functions for the plants that produce them. Key among these functions are nourishment of the embryo, dispersal to a new location, and dormancy during unfavorable conditions.

5 0
3 years ago
Other questions:
  • Unlike other animals, mammals can perspire. The main benefit of perspiring is that it -
    6·2 answers
  • If a segment of one of the DNA strands being replicated consists of CGAATG, what will be the base sequence of the corresponding
    8·1 answer
  • Which of the following kingdoms contains prokaryotes?
    8·2 answers
  • What does biotechnology mean
    10·2 answers
  • Please help me answer 4-9 please
    13·1 answer
  • The population size of organisms in an ecosystem is based on a variety of limiting factors. The graph
    8·1 answer
  • Question 6 of 10
    12·1 answer
  • A dragonfly has blue wings. Its mother has blue wings, but its father has colorless wings. Which of these statements explains wh
    13·2 answers
  • 8. Proteins are broken down into a mixture of amino acids by? ​
    12·1 answer
  • When digested, proteins are broken down into _____. glycerol only fatty acids only monosaccharides amino acids both glycerol and
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!