1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
3 years ago
7

sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT

Biology
1 answer:
Nonamiya [84]3 years ago
4 0

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

You might be interested in
True or false: animals perform respiration to create energy, however because plants perform photosynthesis, they do not have to
nata0808 [166]
False since yes photosynthesis does give energy, but respiration allows them to get more energy
4 0
3 years ago
What type(s) of bacterial pathogens commonly cause community acquired pneumonia in the u.s.? make sure to include the full genus
aleksandrvk [35]

The most common type of bacteria that causes community-acquired pneumonia (CAP) is  Streptococcus pneumoniae. Other bacteria that cause CAP include Mycoplasma pneumoniae, Chlamydophila pneumoniae, and Legionella pneumophila. Mycoplasma pneumoniae is known to be the main cause of walking pneumonia.






7 0
3 years ago
Free 19 points -w- hurry and claim em before their gone
irina1246 [14]

Answer:

ok

Explanation:

6 0
3 years ago
Read 2 more answers
What important event in animal evolution marks the beginning of the Cambrian period?
Alenkinab [10]

The appearance of fossils would the the answer.

Although there has been some scientific debate about what fossil strata should mark the beginning of this period, the "International Geological Congress" determined that the Cambrian period was approximately 543 million years ago of which the first appearance in the fossil record of worms that made horizontal burrows was discovered.

3 0
4 years ago
What has been the biggest cause of biodiversity loss? *
saw5 [17]
Habitat destruction is the key one out of all of these. Animals being kept at the zoo for research are usually endangered or vulnerable species which is doing more good than harm to them. Legal hunting of animals is most likely for rabbits, deer, and a stabilized population in the wild. Habitat destruction can destroy many populations and cause loads of damage. An example of that would be the Australian wildfires at the start of 2020.
7 0
3 years ago
Other questions:
  • The number of protons determines the
    10·1 answer
  • Where is the answer
    7·1 answer
  • ____________from the Sun is not matter, although you can see it.<br><br> Fill in the blank
    8·2 answers
  • Which species is mostly likely a producer?
    15·1 answer
  • Which order of diagrams would show primary succession in an area that had never before been occupied by living organisms?
    10·1 answer
  • What is the main purpose of the flowers of a peach tree?
    14·1 answer
  • What fraction of their genetic material does each parent give to their child? Explain why.
    14·1 answer
  • 4. Koalas are herbivores that eat leaves from
    7·1 answer
  • Which is NOT a passive transport mechanism across the membrane of a plant cell?
    12·1 answer
  • In ____________ , a double-stranded RNA molecule separates into single strands. One of the strands prevents a complementary mRNA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!