1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
3 years ago
7

sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT

Biology
1 answer:
Nonamiya [84]3 years ago
4 0

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

You might be interested in
Application of surface tension in respiratory system
likoan [24]

Answer:

The force of surface tension in the lungs is so great that without something to reduce the surface tension, the airways would collapse after exhalation, making re-inflation during inhalation much more difficult and less effective. Collapse of the lungs is called alectasis.

Explanation:

6 0
3 years ago
Chemical transmitters can stimulate any receptor site to initiate an action.
dimaraw [331]
Not true, certain chemical transmitters stimulate certain receptors
4 0
3 years ago
What determines the structure and function of a proteins?
mote1985 [20]

The function of a protein is determined by its shape. The shape of a protein is determined by its primary structure (sequence of amino acids). The sequence of amino acids in a protein is determined by the sequence of nucleotides in the gene (DNA) encoding it.

7 0
3 years ago
Why do clouds tend to form at 3pm and 6am
Verizon [17]
Clouds form as a result of the condensation of water vapor in the atmosphere. They are made of tiny droplets of water. Clouds tend to form between 3pm and 6pm because this is when the region starts to loose or has completely lost the heat form the daily sun. Water vapor will condense once temperatures are low or are decreasing. 
3 0
3 years ago
What traits might transfer across generations within animal species?
Vesna [10]
Biological fitness or darwinian fitness there the same thing
7 0
3 years ago
Other questions:
  • What type of organisms use photosynthesis
    11·1 answer
  • What's the difference between physical and chemical properties
    12·1 answer
  • A scientist wants to compare DNA of two plants. What technique can she use to produce bands of DNA fragments for this comparison
    15·1 answer
  • What is the difference between the cryosphere and the<br> hydrosphere?
    11·1 answer
  • Select the correct answer.
    11·1 answer
  • The red fox lives in temperate regions and has a dark, reddish coat to help it hide from predators. The kit fox is sandy-colored
    6·1 answer
  • Pleaseee helppppp!!!! <br> the most can be just like 4 sentences<br> 20 points !!!!!
    6·1 answer
  • Which one is not a characteristics of normal urine-
    7·1 answer
  • Which variable would be a dependent variable ?
    5·1 answer
  • Which statement correctly demonstrates the relationship between cellular respiration and photosynthesis?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!