1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
2 years ago
7

sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT

Biology
1 answer:
Nonamiya [84]2 years ago
4 0

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

You might be interested in
Which of the following show bases paired correctly?
Luden [163]

A-T G-C A-T G-C

Explanation:

I just took the test hope this helps.

4 0
3 years ago
Why are viruses considered nonliving but bacteria are considered living? Give to reasons.
Andreyy89
Viruses aren't made up of living cells, like plants and animals are, they either consist of DNA or RNA surrounded by coating of protein. Versus also like the properties of living things. They have no energy, they do not produce waste, and they do not respond to stimuli. they do not reproduce independently but must rely on invading living cells and feeding off a them.

Therefore, there are many reasons my viruses are considered non living but the biggest reason is because they cannot survive on their on and have to feed and get their nutrients off of living things

And bacteria is considered living because it can do all these things that viruses cannot do.
8 0
2 years ago
Which indicates the authenticity of a primary source document? Which best compares competition, cooperation, and predation betwe
arsen [322]

Answer: To know if a document is a primary source, check to see when the document is published, if it is an autobiography of a person, a diary, a letter, or the documents happen at the time of the event.

The competition between two organisms can be seen if there is only 1 source of food or habitat space and they're competing against each other for the food or habitat.

There is cooperation between two organisms if they are helping each other with resources or alarming each other if there is danger.

Predation between two organisms happen when one organism hunts the other organism for food.

6 0
3 years ago
What type of reactions build proteins from amino acids??????????
Alona [7]
The type of reaction that build proteins from amino acids are dehydration reactions
3 0
3 years ago
Why are flowers important to the life cycle of some plants but not others?
Rama09 [41]
Helps with oxygen and stuff
3 0
3 years ago
Other questions:
  • The heart is considered a/an _______ and the cardiac muscle that includes it is considered _______
    13·1 answer
  • While sitting in class, sherman suddenly experiences a racing heart, clammy hands, dizziness, and shaking. sherman has many of t
    9·1 answer
  • .   Which of the following are considered the most effective types of reward? 
    15·1 answer
  • A population of lab rats recently escaped into the sewer system of Washington, D.C. A brave researcher sampled this population a
    9·1 answer
  • Let’s assume that dragons show incomplete dominance for fire breathing. The F allele provides lots of fire and the F’ allele giv
    9·1 answer
  • Summary of protein synthesis in DNA pls
    13·1 answer
  • Plants are used on slopes to prevent erosion. Which of these plants would be the best choice to plant on a slope to provide eros
    11·1 answer
  • What causes depersonalization of a nueron membrain potential?
    9·1 answer
  • A diagram shows a potato producing new tubers. Buds on the parent plant grow into stems that grow downwards called stolons. The
    6·1 answer
  • Several tissues are classified as connective tissue, what function is common to all types of connective tissue? Prove your answe
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!