1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
3 years ago
7

sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT

Biology
1 answer:
Nonamiya [84]3 years ago
4 0

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

You might be interested in
Which of the following statements are true regarding olfaction? Check all that apply. a)Smell is a chemical sense. b)Odorant mol
MrRa [10]

Answer:

A.) Smell is a chemical sense.

B.) Odorant molecules dissolve in mucus before stimulating a receptor

C.) Olfactory receptors have hairs on the apical surface that respond to stimuli

7 0
3 years ago
Does peterson's solution to the mutual-exclusion problem shown in fig. 2-24 work when process scheduling is preemptive
Sloan [31]
<span>Yes. Not only does Peterson's Solution work with preemptive scheduling, but it was designed for that very case. In fact, when scheduling is non-preemptive, there is a possibility it might fail. For example, in a case where 'turn' is initially 0, but process 1 runs first, it will loop perpetually, and never release the CPU.</span>
4 0
3 years ago
#1. Another name for unicellular organisms that dominated Earth up to the Precambrian time is A. eukaryotes. B. cyanobacteria. C
dexar [7]
The correct answer for question number 1 is A - eukaryotes are the name for unicellular organisms that dominated earth up to the Precambrian times.

The correct answer for question number 2 is C - the greenhouse effect is related to the phenomenon of an increase in average surface temperature known as global warming.

The correct answer for question number 3 is D - the colourless and odourless gas that is produced by the radioactive decay of Uranium-238 and is considered to be a cancer-causing agent is Radon.

The correct answer for question number 4 is B - Scientists can determine if oxygen existed in Earth's Archean atmosphere by looking for oxidized iron in rocks.
4 0
3 years ago
Plant cells have large, round vacuoles they primarily use for -
Andre45 [30]

Answer: the answer is water storage

Explanation: i just got it right

6 0
3 years ago
Read 2 more answers
Do bananas contain radiation?
Ne4ueva [31]
<span>You are right in that bananas contain potassium and K-40 is a naturally occurring potassium isotope AND the K-40 in an average banana does decay at a rate of about 31 ATOMS per second (half-life is > 1 billion years). This is an extremely low level of radiation and nothing to worry about. Bananas will definitely NOT cause a "nuclear winter."</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • The process in which one species evolves into a variety of species is called apes
    9·1 answer
  • Which of the following is not an example of an extensive physical property? Select one:
    13·2 answers
  • The division of any cell, prokaryotic or eukaryotic, requires that the genetic information in each of the parent cell's chromoso
    8·1 answer
  • Which of the following statements is true?
    9·1 answer
  • What does all living cells have​
    7·2 answers
  • Julie was diagnosed with an aggressive tumor of the thyroid. Surgery was performed to remove the thyroid. However, post-operativ
    15·1 answer
  • Someone please help I'm so lost :(
    5·1 answer
  • Does cellular respiration give a runner more energy than lactic acid fermentation
    9·1 answer
  • List the biotic and abiotic factors in this image
    6·1 answer
  • Which of the domains include
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!