1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
3 years ago
7

sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT

Biology
1 answer:
Nonamiya [84]3 years ago
4 0

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

You might be interested in
Help biomolecule packet pls!
Scilla [17]

Answer:

The answer to your question is:

Explanation:

1 or more double bonds                                    unsaturated

Usually solid at room temperature                    saturated

Molecules are tightly packed togheter             saturated

Usually liquid at room temperature                  unsaturated

Most plant fats                                                    unsaturated

Most animal fats                                                 saturated

3 0
3 years ago
In what phase of meiosis is DNA replicated?
Diano4ka-milaya [45]

Answer:

During prophase I, the chromosomes condense and become visible inside the nucleus. Because each chromosome was duplicated during the S phase that occurred just before prophase I, each now consists of two sister chromatids joined at the centromere.

I hope it's helpful!

5 0
3 years ago
What would happen to the possible variation in gametes if the number if chromosome pairs increased from two to three?
Orlov [11]
<span>If each of the pairs of chromosomes was heterozygous (what gives you the highest potential number of different gametes), then the number of possible gametes increases from 4 to 8 for a diploid organism. To figure out how many are possible, raise the number of homologous chromsomes (2 for a diploid organism) to the power of the number of chromosomes. So if you have two different chromosomes (A and B), raise 2 to the 2nd power (or multiply 2 x 2) and you have 4. If you have chromosomes A, B, and C, then you have 2^3, or 2 x 2 x 2 = 8.

To show possible combinations, AaBb gives you AB, Ab, aB, or ab. AaBbCc gives possible gametes of ABC, ABc, AbC, Abc, aBC, aBc, abC, and abc. </span>
7 0
3 years ago
What is required for sexual reproduction?
Mila [183]
A male and female, sperm and egg.
4 0
3 years ago
Read 2 more answers
The three structural components of the modal model of memory are:
masha68 [24]
These are sensor, registry and short-term memory.
3 0
3 years ago
Other questions:
  • Which of the following tags should be used to retrieve information from a
    8·1 answer
  • A person could survive with only the hindbrain and the
    13·1 answer
  • What's the main purpose of the placenta
    10·1 answer
  • A woman with blood type A has a child with blood type O. She accuses a man who is homozygous for blood type B of being the fathe
    14·1 answer
  • during a natural disaster part of a plnt was damaged if the plant can no longer grow and produce new root cells which of the pla
    12·1 answer
  • What is the purpose of Mitosis? *
    8·2 answers
  • What is the most important reason that sediments at beaches are usually rounded and smooth?
    9·1 answer
  • Repede vâ rog ajutaţima
    9·1 answer
  • DNA technology is used to identify hereditary diseases. DNA technology is used to produce medicines and hormones. DNA technology
    8·2 answers
  • Describe the data used by Watson and Crick to determine the structure of DNA
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!