1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
2 years ago
7

sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT

Biology
1 answer:
Nonamiya [84]2 years ago
4 0

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

You might be interested in
Which of the following is an example of deposition?
oee [108]

Answer:

A: glaciers wearing down layers of rock

Explanation:

Hopefully this helps!

3 0
2 years ago
ii. True or False: Estimates of body composition obtained with dual-energy x-ray absorptiometry need to be interpreted with part
Bogdan [553]

Answer: True

 

Explanation:

The dual energy x-ray absorptimetry is a technique that is used for measuring the bone mineral density. This technique utilizes the two X-ray beams with different levels of energy. The soft tissues are subtracted in this procedure and the beam is absorbed by the bone. This technique is useful for diagnosis of osteoporosis, to check and diagnose the infected, fractured and healing bones.

Fluid retention is a condition in which excess fluid due to capillary leakage or any other reason fills up inside the circulatory system, body tissues and cavities. The following symptoms will appear:

Discolored skin, aches and tenderness in the limbs, stiffness in joints and weight gain.

The retained excess fluid may react with the X-ray beam hence, will interfere in the process of diagnosis. Thus caution should be taken for such individuals.

7 0
2 years ago
What is the first checkpoint in the cell cycle where a cell will be causes to exit the cycle is this pooint is not passed?
Bess [88]
What is produced if a cell divides by mitosis but does not<span> undergo ... 24) Which is the </span>first checkpoint in the cell cycle where a cell will be caused to exit the cycle<span> if ... 28) Which of the following triggers the cell's passage </span>past<span> the G2 </span>checkpoint<span> ... they do so at random </span>points<span> in the cell </span>cycle<span>; they are </span>not<span>subject to cell </span>cycle<span> ...</span>
8 0
2 years ago
Several species of finch live on the Galapagos Islands. They are very similar in appearance, but have adapted beaks of different
oksano4ka [1.4K]

Answer:

D)

Explanation:

This is a prime example of natural selection.

Have a nice day!

-Fitz

5 0
3 years ago
An atom that has fewer neutrons than protons and more electrons thank protons is an
Tju [1.3M]
The atom is a isotope.
3 0
3 years ago
Other questions:
  • Which part of the atom is directly invovled in chemical changes ?
    11·1 answer
  • The four major functions of hormones are?
    9·1 answer
  • Which order of events is correct?
    7·1 answer
  • How are endocrine and exocrine glands different from each other?
    7·1 answer
  • You can use average speed to calculate the speed of an object that is moving at a constant speed.
    7·1 answer
  • Where does the waste material in the body come from and why does the body need to get rid of these waste materials?
    11·2 answers
  • True or False? The low power objective lens has a greater magnification than the high power objective lens.
    11·1 answer
  • What is the difference between the Domains Eukarya and Bacteria
    10·1 answer
  • How do the unique properties of water make it so important for life on earth
    10·2 answers
  • 9. A recessive allele will only be expressed when _______________________ .
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!