1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
3 years ago
7

sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT

Biology
1 answer:
Nonamiya [84]3 years ago
4 0

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

You might be interested in
The major source of glucose to elevate a low blood glucose level is ______ stored in the
scoundrel [369]
Glucagon - stored in the pancreas
7 0
3 years ago
Plankton are low in the food chain.<br> a. True<br> b. False
scoundrel [369]

<span>True plankton are low in the food chain</span>

<span />

6 0
3 years ago
Read 2 more answers
Sharp leaves on the savanna trees protect them from _____.
Ghella [55]
Protects the plant from losing water. The sharp needles of the tree mean that is has less surface area for the sun to make contact. They may also have differently shaped stomata, in order to prevent water loss
7 0
3 years ago
What is the difference between transcription and translation? ​
BigorU [14]

Answer: Transcription is the synthesis of RNA from DNA while Translation is the synthesis of a protein from RNA.

Explanation:

7 0
3 years ago
Which process is responsible for the greatest loss of energy from Earth’s surface into space on a clear night?
lyudmila [28]
Radiation is responsible for the greatest loss of energy. 
3 0
3 years ago
Other questions:
  • Any electricity charged object crates an electric field.Walking across carpet In wool socks can create charge.This observation i
    11·1 answer
  • Why are small quantities of chlorofluorocarbons so harmful to the ozone layer?
    6·1 answer
  • What are the products of photosynthesis ?
    9·2 answers
  • Dogs (Canis lupus familiaris) and gray wolves (Canis lupus) can interbreed to produce viable, fertile offspring. These species s
    13·1 answer
  • The sumatran rhinoceros is one of the world's rarest mammals. found only in borneo, malaysia, and sumatra, there are estimated t
    9·2 answers
  • 34. If only one type of tree is planted in an abandoned<br>field, the ecosystem will​
    12·1 answer
  • If you found a singled-celled organism with a nucleus, circular chromosomes, and the ability to live in extremely salty habitats
    8·1 answer
  • Which of these micropipetters would serve best to deliver 55 microliters?a. 0.5 to 10 µL micropipetter b. 10 - 100 µL micropipet
    6·1 answer
  • If the gametes produced by a given organism contain 6 chromosomes, how many chromosomes are found in that organism’s body cells?
    14·1 answer
  • I need it now plz n ty
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!