1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry_Shevchenko [17]
3 years ago
13

Through an extension program, rural farms were able to cooperate with land-grant colleges while the farms were able to provide e

nrichment programs to the public.
It allowed land-grant colleges to perform experiments in the fields of rural farms.

It reimbursed land-grant colleges for their contributions to agricultural research.

It supplied land-grant colleges with the equipment necessary to perform research.

It gave land-grant colleges the money necessary to pay students for their research.
Geography
1 answer:
guajiro [1.7K]3 years ago
6 0

Answer:

It allowed land-grant colleges to perform experiments in the fields of rural farms.

Explanation:

You might be interested in
Where is the kalahari desert located​
dangina [55]

Answer:

in southern Africa/ south Africa.

Explanation:

3 0
3 years ago
Read 2 more answers
Nuclear materials, water, and fossil fuels are used to produce __________ in Russia. A. Electricity B. Drinking water C. Automob
never [62]

The correct answer is - A. Electricity.

Russia is a country that has an abundance of natural resources, and it uses them in order to produce its own electricity, and does it multiple ways. As one of the countries that has developed nuclear programs from long time ago, Russia has also used this technology in order to build nuclear reactors for the production of electricity. Also, the country has numerous rivers that are very large in every aspect, so lots of hydroelectric capacities have been built in the dams for production of electricity. The fossil fuels are also used on a big scale, and the usage of coal and mazut in the generators for producing electricity is still big.

6 0
3 years ago
In our many voyages to the planet Mars we have been look for signs of life and one primary thing scientist are looking for are s
babymother [125]
Water is the source of life. It is one of the only ways to survive so without water, there is no life.
8 0
2 years ago
Explain how Southern Ontario municipalities are adjusting to co-<br> existing with wildlife.
Anika [276]

Human-wildlife conflicts result when the actions of humans or wildlife have an adverse impact upon the other. Although it is recognized that humans have profoundly impacted wildlife and the environment in many ways, through habitat loss, pollution, introduction and spread of exotic and invasive species, over exploitation, and climate change, this document focuses mostly on those human-wildlife conflicts that result from direct interaction among humans and wildlife. Human-wildlife conflicts vary according to geography, land use patterns, human behaviour, and the habitat and behaviour of wildlife species or individual animals within the species. Principal areas of concern include:

Some wildlife species (g., deer, coyotes, Canada geese, raccoons, black bear) have an economic impact on local farming communities by damaging crops and livestock predation. The Agricultural Advisory Task Team (AATT) appointed in 2004 by the provincial Minister of Agriculture, Food, and Rural Affairs, identified issues of livestock predation and crop damage by wildlife in some regions of Ontario. The AATT recommended that human-wildlife conflict in agricultural areas be recognized and addressed by the provincial government. Human-wildlife conflicts in urban areas often involve wildlife species (g., raccoons, squirrels, Canada geese) that have adapted well to changes to natural habitat resulting from residential development. Impacts in residential areas include structural damage to buildings and landscaping and fouling of parks and recreation areas. Expansion of permanent residential and cottage development in rural areas of the province has also been accompanied by increased human-wildlife conflicts. Vehicle-wildlife collisions result in injury or mortality of both wildlife and humans, as well as substantial damage to motor vehicle Wildlife-plane collisions are also of concern at some airports and runways. The potential for disease transmission between wildlife and domestic animals or to humans is an ongoing concern. While major initiatives have limited the incidence and spread of rabies in Ontario, pathogens such as chronic wasting disease and avian influenza are receiving greater attention at provincial, national and international levels. Populations of some wildlife species can cause ecological impacts that are in conflict with objectives associated with conserving and maintaining biodiversity. For example, intensive foraging by white-tailed deer can alter ecological processes and physically impact habitat of species at risk. There is a need for better understanding and awareness of the nature and complexity of factors contributing to human-wildlife conflicts in Ontario, including climatic factors, land use, agricultural practices and wildlife management initiatives. Reduced winter severity associated with long-term climate change and shifts in agricultural land use practices in recent decades has created favorable environmental conditions for some wildlife species, such as white-tailed deer. There are currently underway enhanced government efforts to conserve and protect species and their habitat. In support of "sustainable development", there is recognition of the importance of the natural environmental in the lives of Ontarians. However, these efforts may have incidental consequences of increasing human- wildlife interactions, which need to be managed to maintain a healthy balance between the need for socio-economic development and protection of the natural environment. The number of people in southern Ontario has increased from 8.5 million in 1980 to 12.4 million in 2004. Future population growth will lead to increased urban and rural development and greater interaction with wildlife, particularly with those species able to adapt to human-induced habitat change.

If i'm wrong, sorry.

5 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • Why is the average annual high temperature in Cape Hatteras,
    8·1 answer
  • What nation is located on the eastern side of the island of hispaniola?
    10·1 answer
  • Differentiate surface waves from body waves?
    9·1 answer
  • The belief that we inherit tried and true ways of adjusting to the environment from past generations is referred to as ______ ev
    7·1 answer
  • The larges lakes in the world are found in:
    9·1 answer
  • Confucianists believe
    11·1 answer
  • Discuss China’s one child policy?
    5·1 answer
  • How did the British try to unify India?
    7·1 answer
  • List down the d/t landform​
    14·1 answer
  • Analyze the map below and answer the question that follows.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!