1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
matrenka [14]
3 years ago
9

The diagram shows a process used to produce apple trees with the desired trait of sweeter fruits.

Biology
2 answers:
Reil [10]3 years ago
6 0

Answer:

D

Explanation:

The diagram shows a process used to produce apple trees with the desired trait of sweeter fruits.

Which labels should be used to complete the diagram?

X: Enzymes

Y: Apple tree DNA

X: Enzymes

Y: Gene for sweeter fruit

X: Apple tree DNA

Y: Gene for sweeter fruit

X: Gene for sweeter fruit

Y: Apple tree DNA

Len [333]3 years ago
4 0

Answer:

D. X: Gene for sweeter fruit

    Y: Apple tree DNA

Explanation:

The process that producing apple trees with desired trait of sweeyer fruits will require gene for sweeter fruit  and apple tree DNA.

Genes are responsible for carrying traits or characterstics from parent to daughter, here the trait is sweetness and genes are must to carry this trait otherwise apple will lack sweetness.

DNA carry instructions which are required to develop, reproduce and survive by an organism. DNA undergoes several processes like replication, transcription and translation and share the DNA of male and female parent (sexual reproduction) to produce new organism or plant. hence, DNA of apple tree will be required.

Hence, the correct option is D.

You might be interested in
Many g protein-coupled receptors contain seven transmembrane α-helical domains. the amino end of the protein lies at the exterio
olga55 [171]
<span><span>The carboxyl end of the G- protein-coupled receptor (GPCR) is located in the cytosol (it is intracellular). Carboxyl terminus is one of the most variable structures of the protein. All of the GPCR  are </span><span>structural and functional similar, unlike their ligands.</span></span>
6 0
3 years ago
What types of cells have half the number of chromosomes ?
Sholpan [36]
Gamates cells have half the chromosomes
6 0
3 years ago
Which sensations result from activation of interoceptors?
svetlana [45]
Pain is one example of a sensation
4 0
3 years ago
Place these events in the correct order of occurrence in the muscle contraction: End plate potential triggers an action potentia
Sunny_sXe [5.5K]

Answer:

1. Acetylcholine binds to receptors on the motor end plate

2. Ligand-gated channels open leading to depolarization

3. End plate potential triggers an action potential  

4. Transverse tubules convey action potentials into the interior of the muscle fiber

5. Calcium is released from the sarcoplasmic reticulum

6. Calcium ions bind to troponin, which then moves tropomyosin

Explanation:

Acetylcholine (ACh) is a signaling molecule (neurotransmitter) that binds to receptors on muscle cells. This binding triggers the opening of ligand-gated sodium channels, thereby ions enter into muscle cells, which causes the depolarization of the sarcolemma and thus promotes the release of Ca2+ ions from the sarcoplasmic reticulum. The myoneural junction, also known as the motor endplate, is the site of synaptic contact between a motor axon and a skeletal muscle fiber. The endplate potential is the voltage that produces the depolarization of muscle fibers when ACh molecules bind to their receptors in the cell membrane. This depolarization spreads in the sarcolemma through transverse tubules (T tubules​) and thus generates an action potential. Finally, this action potential induces the release of Ca2+ in the sarcoplasmic reticulum, which activates troponin protein and induces muscle contraction.

4 0
3 years ago
What section of the brain controls the ability to move your right hand?
Vika [28.1K]
The left hemisphere of the cerebrum controls the ability to move and control your right hand 
3 0
3 years ago
Other questions:
  • Climate distribution of earth is primarily controlled by:
    14·1 answer
  • Which statement best describes an invasive species
    5·1 answer
  • William is interested in exercising more, but does not feel he has the time. Write a short response explaining how he can find t
    9·1 answer
  • Which of the following ia a main goal of a species survival Plan
    6·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What are the genotypes of the parents? I'm guessing it's Yy and yy, but I'm not exactly sure.​
    14·2 answers
  • What are the four ways that RNA differs from DNA?
    13·2 answers
  • How is the phloem in a leaf related to the roots of the plant?
    7·1 answer
  • Using the food web we’ve been working with, what should affect moose population growth?
    14·1 answer
  • all other factors (concentration, solute size, etc.) being equal, which type of solute does a cell tend to pull inside?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!