In aquatic plants, water passes among the tissues and provides the medium for gas exchange. In terrestrial plants, air enters the tissues, and the gases diffuse into the moisture bathing the internal cells.
Hope this helps
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The right matches are:
• Involves the transfer of genetic material from one bacteria to another ==> Genetic recombination (all 3).
• Involves scraps of genetic material ==> Transformation.
• Uses a virus to transmit genetic material ==> Transduction.
• Uses a pilus to transmit genetic information ==> Conjugation.
• Introduces new genetic material to a bacterium ==> Genetic recombination (all 3).
In molecular biology the term genetic recombination is often used as a synonym for DNA recombination, that is, the processes by which one DNA (or RNA) molecule is cut off, then joined to another.
There are three possible mechanisms in the bacterium: bacterial conjugation, bacterial transformation and transduction.
Answer:
Cells
Explanation:
Cells are the smallest living unit, but atoms are the smallest unit of the above choices... Cells are made of atoms... But you asked about the Smallest unit of life so I don't know if you are asking about the smallest unit ever or the smallest unit in the living things
