1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lidiya [134]
3 years ago
6

Which is asserted that the united states had the right to intervene in the affairs of neighboring american countries

Biology
1 answer:
gayaneshka [121]3 years ago
3 0

Answer:

Roosevelt Corollary

Explanation:

The Roosevelt Corollary was to support the Monroe Doctrine established in 1904 by President Theodore Roosevelt after the Venezuela Crisis of 1902–1903. it gives the United States the ability to intervene in conflicts among the European countries and Latin American countries to Make sure such claims are looked into rather than enacted by European powers on these Latin American countries

It also gifts the United States the right to "international police power" to cut short serious unrest in the Western Hemisphere.

You might be interested in
. What causes cells to stop dividing?
LekaFEV [45]
Love and Unity :) just kiddddding aging cells stop dividing because they become senescent. They do this by sending chemical signals to each other so that they know
4 0
3 years ago
How do plant cells react when they are placed in an environment with a lower water concentration than inside of the cell? A. Pla
polet [3.4K]

plant cells lose water.

7 0
3 years ago
Read 2 more answers
Enzymes are involved in biochemical reactions within the cells of all living organisms. Which statement best describes how enzym
uranmaximum [27]
I think it is A but not 100% sure. Think of an enzyme like a key unlock the lock is the protein. And to activate getting inside your car or house you have to fit the key into the lock.
4 0
3 years ago
What are possible origins of Earth's surface and internal energy?
saul85 [17]

Answer:

The flow of heat from Earth's interior to the surface is estimated at 47±2 terawatts (TW) and comes from two main sources in roughly equal amounts: the radiogenic heat produced by the radioactive decay of isotopes in the mantle and crust, and the primordial heat left over from the formation of Earth.

3 0
2 years ago
Explain how endocytosis, digestive enzymes and exocytosis work together to get rid of bacteria
erma4kov [3.2K]

Answer:  Endocytosis brings materials to the inside of the cell while exo takes them out. Exoocytosis has the vesicle being formed in the golgi apparatus which then fuses with the membrane, while endo has the vesicle. formed from the cell membrane which then gets into the cytoplasm.

6 0
3 years ago
Other questions:
  • Why is it important that cells contain catalase?
    12·1 answer
  • Hydroelectric power does not require moving water as dams hold water back.
    8·2 answers
  • "what enzyme is responsible for the process seen here"
    12·1 answer
  • Is his study of pea plants, Gregor Mendel used which method to produce offsprings?
    8·1 answer
  • Which is represented by the image?
    15·1 answer
  • PLEASE HELP GIVING 25 POINTS
    9·2 answers
  • "G1 or "Gap 1" phase is also commonly referred to as the
    15·2 answers
  • Fill in the blank.
    15·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What causes smog in L.A. and in Mexico City? Describe at least factors.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!