Proteins function optimally at a specific temperature. So if you get too hot or too cold, biochemical reactions in your body start to function less well. If the situation becomes extreme enough, they can cease to function well enough to sustain life.
Warm-blooded animals have an advantage over cold-blooded ones in that their bodies automatically try to maintain the optimal termperature for things in their bodies to function. Cold-blooded animals depend on the environmental temperature to do this for them. That's why reptiles are very sluggish when they're cold, but will "wake up" when they get warm.
The cost to this benefit is that metabolically, warm-blooded animals require a lot more fuel to run their bodies. It's very energy-intensive to maintain a constant body temperature. Cold-blooded animals require far less fuel than warm-blooded ones relative to their size.
The way that proteins operate in a specific temperature is also true of the pH in your body which is also very tightly maintained.
In a cornfield, only one plant species has dominated the area, that is the corn plant. While in a natural meadow, multiple species of plants occurs of different species. The presence of the different types of plants in the meadow will interact more number of insects in it as compared to the corn field. This will lead to more interactions among the different species in a natural meadow. The greater biodiversity of the natural meadow than the cornfield will support it better.
In case of any natural disaster, or a pest attack, all the plants will be killed in a corn field and so will the insects dependent on them, but in a natural meadow, if one plant species is killed by a natural disaster, other will still be alive. Hence, the ability to survive is greater in natural meadow.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
True, temperature and precipitation affect the overall weather and climate of a place.
Answer:
nucleic acids.
Explanation:
The fusion of the sperm with the egg results in the formation of a zygote that develops into a new offspring. Twins refers to the two offspring which are a result of the same pregnancy. They are of two types. Monozygotic twins are a result of the single zygote (formed by the fusion of one egg with a single sperm) spiltting into two embryos forming the identical twins. Dizygotic twins are a result of two eggs fertilized with two different sperms forming the fraternal twins.
Identical twins are genetically simliar. The genetic material is derived from the same embryo and thus, the DNA of the identical twins are nearly identical. The spilitting of the embryo formed results in the separation of the same genetic material or identical DNA getting incorporated into the twins making them look alike in majority of the cases.
