1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pickupchik [31]
2 years ago
7

Which types of tissue make up the lungs?

Biology
2 answers:
finlep [7]2 years ago
7 0
<span>Tissues that make up the lungs include bronchioles, epithelial cells, smooth muscle cells and alveoli</span>
Kisachek [45]2 years ago
6 0
The tissues that make up the lungs include bronchioles<span>, </span>epithelial cells<span>, smooth </span>muscle cells<span> and </span>alveoli.
You might be interested in
Protein synthesis can be compared to building a doghouse. Sondra wanted to build a doghouse and found a book in the reference se
Nimfa-mama [501]

The correct answer is mRNA.

mRNA or messenger RNA is synthesized during the process of transcription, from DNA molecule which is used as a template. mRNA contains information about protein synthesis (translation) in the form of nucleotide triplets or codons.

In the example above: reference book is DNA molecule (template for copies), copies are mRNA, wood is amino acids (building blocks) and doghouse is protein.

5 0
3 years ago
Homologous pairs separate in meiosis , and sister chromatids separate in meiosis .
puteri [66]

Answer:

Homologous pairs separate in first round of meiosis or meiosis 1

However,

sister chromatids separate in second round of meiosis or meiosis 2.

6 0
2 years ago
By what process do most bacteria divide? *
djverab [1.8K]

Answer:

The answer to your question is: D. Binary fission

Explanation:

A. Mitosis  This is the process by which somatic cell divide, from 1 cell the result is 2 cells.

B. Meiosis   This is process by which reproductive cells divide, the product of this process is 4 daughter cells.

C. Conjugation  is a process by which bacteria transfer DNA to another cell but is not a process of division.

D. Binary fission , this is the process by which Bacteria reproduce, the result of the mechanism is 2 identical daughter cells.

7 0
2 years ago
What is the difference between a single gene disorder, multifactorial disorder and a chromosomal abnormality?
photoshop1234 [79]
There are approximately 25,000 genes contained on the 46 chromosomes in each cell of the human body. This means that one chromosome contains thousands of genes. A person can have normal chromosomes in number and structure, but still have a disease or condition caused by a mutation in one or more of the genes on the chromosomes. A single gene defect usually does not cause the chromosome structure or number to be abnormal. Similarly, a person can have normal genes; however, if the person has extra copies of genes due to a chromosome abnormality, then those extra copies can cause the genes to not work properly.
5 0
2 years ago
Katrina inserts a key into her car’s ignition. She turns the key, putting her car into ignition mode. In this mode, some energy
swat32

Answer is chemical energy.

The fuel used in car is petroleum product which is a fossil fuel.  Petroleum products such as petrol or diesel are chemical compounds in which chemical energy is stored in their bonds. When these compounds undergo chemical reactions, resulting in breaking of bonds and releasing energy. When ignition of a car is on, the energy is released when chemical bonds are broken. The released energy is carry out work in the car system.

8 0
3 years ago
Read 2 more answers
Other questions:
  • A living thing is surrounded by its
    13·1 answer
  • How does a muti-celluar organisms organise
    7·1 answer
  • _______ are responsible for converting sensory messages into neural impulses.
    10·2 answers
  • Will give brainliest to first correct answer.
    9·2 answers
  • Does anyone want to get payed good money to do my homework?
    15·1 answer
  • Environmental factors carn have various effects on ecosystems. In August 2005, Hurricane Katrina caused signifcant damage in sev
    10·2 answers
  • HELP!!! please and thank you
    13·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • If the manta ray gets 50 kcal of energy by eating the
    11·1 answer
  • HELP PLEASE I WILL MARK BRAINLIEST
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!