Well, contour lines are used to signify a three-dimensional image of a flat surfaces. They are commonly used on topographic maps. Here contour lines connect continuous points of equal elevation. There is a connection between the change of height and the relative change of distance. If you move from one contour line to another then there is a change of height. The closer the lines are the 'faster' the height changes, and thus the 'steeper' the terrain. The further apart the contour lines are, the greater distance over which height changes, the slope is gentler.
Phospholipids. Phospholipids, arranged in a bilayer, make up the basic fabric of the plasma membrane. They are well-suited for this role because they are amphipathic, meaning that they have both hydrophilic and hydrophobic regions. Chemical structure of a phospholipid, showing the hydrophilic head and hydrophobic tails ..
Recombinant DNA techniques, for example, increase milk productions in cows. Another example would be, transgenic salmon grow faster than wild salmon.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
