1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verizon [17]
3 years ago
7

When completing the water properties lab, which property of water was responsible for the water molecules sticking to the penny?

cohesion adhesion high specific heat both cohesion and adhesion
Biology
2 answers:
Genrish500 [490]3 years ago
7 0
The answer is cohesion because co means together and so it means to stick together
Effectus [21]3 years ago
5 0

Answer:

Its cohesion

Explanation:

I took the test, and cohesion is when the molecules stick together and hold, and it allows more of it to stay on a surface

You might be interested in
Dendritic cells and macrophages kill by ingestion and destruction of particulate matter in a process called phagocytosis. Dendri
Korvikt [17]

Answer:

The statement is true

Explanation:

Hematopoietic stem cells give rise to myeloid progenitor and lymphoid progenitor and these two progenitors give rise to many immune cells. Dendritic cells are produced by both the progenitors and macrophages are produced by myeloid progenitor.

Both macrophages and dendritic cells are phagocytes. In phagocytosis, the foreing particles are injected by these phagocytes and they are destryoyed by the action of digestive enzymes present in these phagocytic cells.  

Macrophages are present in tissue and if they are present in blood they are called monocytes. Therefore the statement is true.

6 0
2 years ago
What is DNA polymerase?
Romashka-Z-Leto [24]

Answer:

Not all bats hibernate. Even though bears and bats are the two most well-known hibernators, not all bats spend their winter in caves. Some bat species like the spotted bat survive by migrating in search of food to warmer areas when it gets chilly.

Explanation:

the answer is d

3 0
2 years ago
In celiac disease, the body's immune system destroys which structure?
Leviafan [203]
A. Vili in stomach. And this is because of gluten.
7 0
2 years ago
Which organisms develop gills from pharyngeal arches and later develop lungs to breathe on land? Frog Scallop Salamander Scorpio
Sladkaya [172]

Answer:

frog

Explanation:

frogs live their first part of their lives in water so they need gills but after metamorphosis they live on land so they need lungs.

5 0
3 years ago
Read 2 more answers
4. Which of the following are examples of matter?
Sunny_sXe [5.5K]

Answer:

D, C, F, E, A, B, G, H

Explanation:

  • <u>These all are matter.</u>
4 0
2 years ago
Other questions:
  • Describe thecontributions of mendel to thefoundation of modern genetics
    10·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What have you learned about radioactive dating? Check all that apply.​
    15·1 answer
  • Which of these statements about the afferent division of the nervous system is true?It ascends with sensory information.It desce
    9·1 answer
  • How are animal cells different from plant cells in terms of their shapes? (Use 3 sentences)
    15·1 answer
  • How to prevent bias in scientific investigation
    13·1 answer
  • At which stage would centromeres of sister chromatids Disjoin and chromatids separate?
    10·1 answer
  • 3. It is a genetic code that gives us all of our physical
    12·1 answer
  • Which of the following statements best describes the process of photosynthesis?
    9·1 answer
  • 1. Many plants get energy from sunlight. 2. heterotroph get energy by eating other organisms.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!