1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Orlov [11]
3 years ago
5

Which lists the steps of Meiosis II in the correct order?

Biology
2 answers:
Sonbull [250]3 years ago
6 0

Answer:

B. prophase II, metaphase II, anaphase II, telophase II

Explanation:

harkovskaia [24]3 years ago
4 0

Answer: Prophase II, metaphase II, anaphase II, and telophase II

Explanation: In prophase the spindle forms to prepare the chromatids for splitting. Metaphase lines up the chromosomes at the equator. In anaphase, the sister chromatids split, and in telophase seperate cells are created.

You might be interested in
Can someone please help me?
oee [108]
Hitherei thinkthe answeris1
4 0
3 years ago
Read 2 more answers
Why does the northern hemisphere experience Spring in March, while the Southern Hemisphere experiences fall?
Assoli18 [71]

Explanation:

because the tilt of the earth on its axis

7 0
3 years ago
Read 2 more answers
MRNA carries the message of which proteins to make from the _____ to the _____
sergiy2304 [10]
Nucleus to the ribosomes, I think.
8 0
3 years ago
Read 2 more answers
1. Chemical weathering occurs more rapidly in what kind of climates?
zzz [600]
<span>Chemical weathering occurs more rapidly in a hot and wet climate. Chemical processes like chemical weathering happens rapidly during high temperature, specifically during warm but damp climates. So, on the first question, the answer is letter A. On the second question, the statement that best describes rill erosion is letter D. Rill erosion is the removal of soil by a running water that cuts and forms small channels into a slope or streamlets.</span>
5 0
4 years ago
Read 2 more answers
Introduction: The 19th century was the time of the Industrial Revolution in England. Most of the new
bagirrra123 [75]

Answer: Light colored peppered moths decreases in number and dark colored peppered moths increases.

Explanation: The population of light colored peppered moths decreases whereas the dark colored peppered moths increases in number because the light colored peppered moths are visible to the predator birds  whereas the dark colored peppered moths are not visible due to dark coating of the trees so they are saved from the birds and therefore, increase in population of dark colored peppered moths occurs and decrease occur in light colored peppered moths population.

3 0
2 years ago
Other questions:
  • A bald eagle and a black bear both have four limbs with digits because they are both tetrapods, descendants of a four-limbed anc
    9·1 answer
  • Name 3 things that proteins help your body to do
    13·1 answer
  • What organ in a chicken is responsible for the protein deposition in the albumin?
    5·1 answer
  • What is the dependent variable​
    6·2 answers
  • Please help!!
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What are new stars that are found in the spiral arms and formed from recycled dead star material known as?
    8·2 answers
  • Why do I not get sick when I eat cheese with holes in it, but I do get sick when I eat chicken that has gone bad?
    10·1 answer
  • What is the difference between specialized plant and animal cells
    10·2 answers
  • What is the difference between a species and a population?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!