1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oduvanchick [21]
3 years ago
14

The star turns matter into energy is the process of______

Biology
1 answer:
evablogger [386]3 years ago
3 0

The star turns matter into energy is the process of nuclear fusion. Nuclear fusion is a process where two or more atomic nuclei fuse to make a single denser, or larger nucleus.

You might be interested in
A new pest is found that only feeds on corn plant leaves. Livestock eat corn cobs. Which promoter would you choose if the modifi
aleksandrvk [35]

Answer:

Promoter 2

Explanation:

Promoter 2 is the best choice because the resistance gene will only be expressed in the leaves of the corn plant. Promoter 3 only expresses genes in the corn roots, so the toxin would not be available in the leaves for the pest to eat. Promoters 1 and 4 would express the resistance gene in the leaves of the corn plant, but the toxins would be expressed in the corn cobs as well, which may then be fed to livestock.

8 0
3 years ago
What molecules is this?​
Kamila [148]
I’m pretty sure the C molecules are carbon dioxide? And the O molecules are Oxygen? yeah.. I’m pretty sure
8 0
4 years ago
What would happen if the producers were removed from an ecosystem?
Elden [556K]
If producers were removed from an ecosystem, it would fall apart. Producers are the organisms at the bottom of the food chain, which produce glucose and nutrients for consumers. If producers were removed from an ecosystem, the consumers would have no nutrients and die, causing their predators to die, and so on.
7 0
3 years ago
What is an invasive species?
Serga [27]

Answer:

An invasive species is an organism that causes ecological or economic harm in a new environment where it is not native.

Explanation:

Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. An invasive species can be introduced to a new area via the ballast water of oceangoing ships, intentional and accidental releases of aquaculture species, aquarium specimens or bait, and other means.

Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats. This can result in huge economic impacts and fundamental disruptions of coastal and Great Lakes ecosystems.

6 0
2 years ago
What is the avarage time it takes to decompose a frog all the way?​
Keith_Richards [23]

Answer:

depending on conditions !

Explanation:

e.g a peat bog or somewhere like the north pole vs a humid jungle or hot desert

things to consider

air composition in the environment to feed microbes

temperature to speed up reactions

any natural catalysts

PH of your environment

8 0
3 years ago
Other questions:
  • Scientists find dense rock on Earth's surface that is made of magnesium and smaller amounts of silicon. What layer of Earth migh
    5·2 answers
  • Which of these is not an environmental effect of deforestation?
    15·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What do you notice about the elements on the reactant and produce side of the equation
    15·1 answer
  • What are the two types of surface waves? Describe them.
    9·1 answer
  • When an ADP molecule gains a phosphate, it becomes an ATP molecule. This process is called _____.
    14·2 answers
  • If a woman who is heterozygous for the hemophilia trait and a hemophiliac man have children, what percentage of their sons would
    10·1 answer
  • Probability predictions are based on ____ numbers of events.
    8·1 answer
  • hello! I had one quick question I wanted to ask just to make sure I was right. the question is "How do animals obtain the energy
    7·1 answer
  • 7.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!