1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Troyanec [42]
3 years ago
14

Which of the following is a characteristic that could be applied to both living and nonliving things

Biology
1 answer:
frez [133]3 years ago
7 0
Contain mostly carbon,hydrogen,oxygen,and nitrogen
You might be interested in
50 POINTS+ BRAINLIEST!
m_a_m_a [10]

Answer:

B.) Oceanic crust

Explanation:

The oceanic crust is generally thinner than other Earth layers. The oceanic crust is the thinnest layer of the Earth, amounting for less than 1 percentage of earth's volume.

5 0
2 years ago
How did Watson and cricks model of DNA incorporate the research of other scientists ?
krok68 [10]
They looked and saw Rosalind Franklin's X-ray crystallography which sparked them to think about the double-helix structure, and from there, they played around with cafeteria items (forks and spoons and whatnot) to create a model that finally worked.
4 0
3 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Select the correct answer.
dmitriy555 [2]

Answer:

A. It stops the release of eggs from the ovaries.

Explanation:

Emergency contraception stops the process of ovulation or releasing of the egg during pregnancy.  It reduces the risk of getting pregnant after having an intercourse.

3 0
3 years ago
What subatomic particles make up the nucleus of an atom? Check all that apply.
irina [24]

Answer:

• neutrons

• protons

Explanation:

The nucleus is made up of two types of subatomic particles, that is the protons and neutrons.

5 0
2 years ago
Other questions:
  • Which structure is the interface between the blood systems of a mother and her fetus
    9·2 answers
  • Label the generations: P, F1, F2, pure, hybrid, and make notes of Mendel’s observations. Which generation would your Mom’s grand
    15·1 answer
  • What is the pOH if a solution composed of 60mL of 0.0012M HCl and 200 mL of 0.0005M NaOH?
    15·1 answer
  • Urgent !!! Homework help!!
    7·2 answers
  • Which might be a cause for the increase in songbirds at the feeders?
    8·2 answers
  • This occurs when a shadow makes the sun or the moon seem to grow dark
    13·1 answer
  • The pyruvate dehydrogenase is allosterically inhibited by all of the following except?
    9·2 answers
  • Which of the following does not occur during mitosis?
    6·2 answers
  • What activities do cells need energy to perform
    7·1 answer
  • Use the following table to answer the question:
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!