1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
14

A zoologist has been studying the annual migration of a species over a period of years. He missed the annual event on two occasi

ons. At the end of six years, he submits his report, which includes the graph above. From his data, he concludes that the number of animals migrating is decreasing every year in a linear manner. What mistake has he made?
Biology
2 answers:
julia-pushkina [17]3 years ago
6 0
It isn't completely linear, since he didn't collect data on two occasions. His data would be wrong. (He made assumptions)
konstantin123 [22]3 years ago
4 0

He has not accounted for the two years he missed.

You might be interested in
What inferences can you make regarding the pH of a particular part of the digestive system and the type and relative size of the
djverab [1.8K]
The pH of the stomach in the digestive system is known to be very low, and acidic, so it can break the bonds between molecules, to which the nutrients diffuse into your blood, energizing you.
3 0
3 years ago
Tell whether if the statement is TRUE or FALSE. Oscar Wilde makes an unexpected association between poems and flower petals in "
olchik [2.2K]
It is a completely false statement that <span>Oscar Wilde makes an unexpected association between poems and flower petals in "To My Wife." The correct option among the two options that are given in the question is the second option. I hope that this is the answer that has come to your desired help.</span>
3 0
3 years ago
Exposure to the building material asbestos has been linked to certain types of cancers. Asbestos causes mutations in the p53 gen
Alik [6]

Answer:

Explanation:

A

6 0
3 years ago
Read 2 more answers
Need help I will give you 20 points plsss
dybincka [34]

Answer:

III3 will be "pp" lower case p

II2 will be Pp

Explanation:

As we know the trait is caused by dominant alleles. III3 is not affected so she will have two recessice alleles so 2 lower case p.

III2 is affected so the person will have one dominant allele P and one recessive. The dominant is from the father and the recessive is from the mother.

Hope that helps

7 0
3 years ago
Read 2 more answers
All the gametes of isogamous organisms are genetically identical.<br><br> True<br> False
Lady bird [3.3K]

Answer:

False

Explanation:

Gametes are formed by meiotic division, and classified by shape, size and activity. In some species they are undifferentiated, that is, isogamous, resembling, but not identical, regardless of gender. However, most species have heterogeneous gametes (anisogamy), differentiated by morphological, dimensional and mobility aspects.

6 0
3 years ago
Other questions:
  • Which four elements are most commonly found in nucleic acids
    13·2 answers
  • Helpppppppppppp plzzzzzzzzzzzzzzzxx
    8·2 answers
  • Bronchiole dilation resulting from chronic infections is present in ____________. bronchiectasis chronic obstructive pulmonary d
    10·1 answer
  • How is a cup of hot chocolate with an ice cube a system?
    10·1 answer
  • How do the properties of water contribute to transpiration
    12·1 answer
  • Why does telomerase have to have a built-in template for dna synthesis?
    11·1 answer
  • PLS HELP SUPER EASY FOR SMART PEOPLE! (Not Math btw)
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Explain why stress - strain curve usually has two segments
    13·2 answers
  • What % of the brain is made up of water?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!