1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
r-ruslan [8.4K]
3 years ago
13

a chart that shows all the possible combinations of alleles that can result from a genetic cross is called a(n) __________

Biology
1 answer:
kifflom [539]3 years ago
7 0
Hey Leeann479!

The chart that shows all the possible combinations of alleles that can result from a genetic cross is called a Punnett Square! I've attached an example of one to this answer. 

Hope this helps!

(image credit: Wikipedia)

You might be interested in
If you were to repeat the Meselson Stahl experiments, but rather than use N15 and N14, you use P32 and P31, how would the result
bonufazy [111]

Answer:

The correct answer will be option-C

Explanation:

The CsCl gradient centrifugation in Meselson Stahl experiments is done to separate the bands of the DNA containing isotopes on the basis of difference in the density.

In the experiment, bacterial cultures were grown in the medium of 15N and 14N but if we repeat the experiment with P32 and P31 instead of 15N and 14N and centrifugation is performed then the banding pattern will be the same as of the previous experiment as the method of the replication is same that is semi-conservative.

Thus, Option-C is the correct answer.

4 0
3 years ago
what is the function of vesicles in the synthesis of proteins and the release of those proteins outside the cell
miss Akunina [59]

The purpose of vesicles is simply water retention

8 0
2 years ago
What's a success you have had this week?
exis [7]

Answer:

I got to the next level on brainly

8 0
3 years ago
Read 2 more answers
List the differences of Eukaryotic and Prokaryotic cells. <br><br><br>- Thank you :)​
shtirl [24]

Answer:

Eukaryotes are more complex they have a nucleus prokaryotes do not have a nucleus humans fungi plants and protists fall under Eukaryotes and bacteria is an example of prokaryotes

Explanation:

hope this helps :) this took me a while! :)

6 0
2 years ago
Read 2 more answers
The atomic number of an element is the same as the number of _________ in each atom.
muminat
Neutrons plus protons
4 0
3 years ago
Other questions:
  • Meiosis results in _____.
    13·1 answer
  • Most energy enters ecosystems in the form of sunlight. Please select the best answer from the choices provided T F
    14·1 answer
  • Which of the following are possible causes of global warming
    7·2 answers
  • hyponatremia is a condition in which the sodium in the blood is too low. Uncontrolled spasms, which are sudden, involuntary cont
    15·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The word heterotroph means “other-feeder” or _____________.
    9·1 answer
  • Which statements describe an interaction between the biosphere and the atmosphere related to photosynthesis? Check all that appl
    11·2 answers
  • NOT 100% SURE SO WANT FEEDBACK!!!WILL GIVE BRAINLIEST, RATE AND VOTE!!!AT LEAST TAKE A LOOK!!!!!!!!
    9·1 answer
  • Which statement describes one thing that must happen during the founder effect?
    9·1 answer
  • What is the role of the enzyme diaphorase
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!