1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
3 years ago
12

at certin times of the year, the male sage grouse can be seen inflating the air sacs on his chest and singing loudly to a femal

sage grouse. This behavior is likely an example of a(n)
Biology
1 answer:
qwelly [4]3 years ago
4 0
Courtship Ritual :))
You might be interested in
Which of the following is TRUE regarding angiogenesis?
Nookie1986 [14]

Answer:

a. the process by which new blood vessels develop

c. undelies much of the growth and spread of different cancers

d. controlled by vascular endothelial growth factor (VEGF)

e. occurs with endurance training

Explanation:

Angiogenesis is the process of forming new blood vessels in the human body. The new blood vessels formed by growth, migration and differentiation of the endothelial cells located in the wall of blood cells. The formation of new blood cells (angiogenesis) is under control of vascular endothelial growth factor (VEGF). The new blood vessels provides oxygen and nutrients to the growing tumors, angiogenesis helps in growth and spread of cancer.

4 0
4 years ago
Please help I would appreciate it/)
Harrizon [31]

Answer:

The very bottom one

Explanation:

Thymine and Adenine always pair together while cytosine and guanine go together.

4 0
3 years ago
How are organisms in the kingdoms Fungi and Animalia similar?
yarga [219]

Answer:

their trophic level, neither fungi nor animals are producers, both must use external food sources for energy.

3 0
3 years ago
_Which molecule is the enzyme in this experiment?
Yanka [14]

Answer:

What experiment?

Explanation:

7 0
4 years ago
Relate the balance of predator and prey to carrying capacity.
Ede4ka [16]

Answer:

show the diagram bro

Explanation:

ok bye

7 0
3 years ago
Other questions:
  • ____________________ is a mechanism for change in a population in which organisms with favorable variations live, reproduce, and
    11·2 answers
  • What is an example of a genetic disorder caused by a substitution mutation?
    13·1 answer
  • What are the two portions of lipid molecules?
    5·1 answer
  • What are animals that do this in the soil: create holes for air and water to reach bedrock?
    12·1 answer
  • Biology help??? Anyone know these questions??
    14·2 answers
  • How does the process of translation differ between prokaryotes and eukaryotes?
    7·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The mesentery (MESS un tayr ree) is a structure that’s connects the loops of the small intestine l. The mesentery binds the inte
    7·1 answer
  • Which of the following statements is true?
    11·1 answer
  • All matter has:<br><br> cells<br> properties<br> seeds
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!