1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Romashka-Z-Leto [24]
2 years ago
13

Which stars can be smaller than the sun? select all that apply.

Biology
1 answer:
ehidna [41]2 years ago
8 0
Neutron stars and white dwarfs if we're talking in only size and not mass
You might be interested in
Answer friends , pls
maria [59]
6CO^2 + 6H2O—->sunlight C6H12O6+6O2
7 0
3 years ago
Phosphorus is usually a(n) ...
GenaCL600 [577]

Phosphorus is usually a limiting factor or element.

<h3>Is phosphorus a limiting element or factor?</h3>

Phosphorus is usually considered a limiting factor or nutrient in aquatic ecosystems, meaning that the available quantity of this nutrient controls the pace at which algae and aquatic plants are produced.

In other words, phosphorus is a limiting nutrient for aquatic organisms. Its supply is usually small compared to available aquatic organisms.

Thus, Phosphorus is usually a limiting factor or element.

Learn more about phosphorus here: brainly.com/question/1357744

#SPJ1

3 0
1 year ago
Necesito ayuda Comparaciones del sistema digestivo de los animales: Rana, tiburón, gallina, vaca e iguana
Grace [21]

Answer:

The digestive system of Frog, shark, chicken and cow are the following:

Explanation:

The digestive tract of frog is divided into foregut that consist of esophagus, stomach, duodenum, liver, pancreas, gall bladder and midgut/hindgut where intestine is present. The digestive system of frog comprise of oral cavity, pharynx, esophagus, stomach and intestine. The digestive system of chicken consist of beak, crop, proventricular, ventriculus, small Intestine, large Intestine and Cloaca. The digestive system of cow comprise of mouth, esophagus, rumen, reticulum, omasum, abomasum,  small intestine and large intestine.

5 0
2 years ago
Which resource is a nonrenewable resource?
garri49 [273]
Loljzjsjshjsjshsusjjshsjs
6 0
2 years ago
Read 2 more answers
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
2 years ago
Other questions:
  • Match these items.
    11·1 answer
  • Molecular data can be used to assess relationships among the major groups of living organisms whose common ancestors lived milli
    5·1 answer
  • a vegtable garden is 12 meters long by 7 meters wide in one square meter, you count two toads. estimate the population of toads
    6·1 answer
  • Identify the term indicated by this description. A high level cloud.
    6·2 answers
  • Nuclear energy is a useful source of power but has disadvantages. What is a
    7·2 answers
  • John had a science fair project that he needed to do. He wanted to test the effects that organic and chemical fertilizers had on
    10·1 answer
  • G1 – growth phase: Makes organelles and proteins needed for replication of DNA. Also contains a G1 checkpoint. If everything is
    14·1 answer
  • I been trying to fund a Structure of -a-D-maltose can someone help me?
    13·1 answer
  • The phospholipid bilayer describes a structure with:
    12·1 answer
  • Cual es el mensaje que te transmite el cuento los tres cerditos
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!