1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flauer [41]
2 years ago
12

What is the role of microfilaments in cell division?

Biology
2 answers:
Romashka-Z-Leto [24]2 years ago
7 0

Answer:

The pull the cell membrane in.

Explanation:

I took the quiz.

Sedbober [7]2 years ago
6 0
Another important function of microfilaments is to help divide the cell during mitosis (cell division) microfilaments aid the process of cytokinesis which is when the cell “pinches off” and physically separated into two daughter cells
You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Label each level of dna packaging in the eukaryotic chromosome with the appropriate term.
Lostsunrise [7]
I assume this photo has the labels you are talking about.

DNA double helix consists of two strands that wind around each other with their nucleotides liked.-> it's the structure number 5
 nucleosome- it's a segment of DNA wound in sequence around eight histones (proteins)- number 2
Histone- proteins with DNA around them, forming the nucleosome- number 4
Tight helical fiber- chromatin <span>coiled very tightly- 3
Cromosome- </span><span>chromatin condensed even tighter forming a X shape.- 1</span>








3 0
3 years ago
Read 2 more answers
When alleles are neither dominant or recessive, so both alleles are expressed, is
vampirchik [111]

Answer:

hmoocigtoos

Explanation:

homocigotios

8 0
3 years ago
In one kind of abnormal chromosome inheritance called down syndrome, a child has three copies of
umka2103 [35]
The answer would be B. chromosome 21 

3 0
3 years ago
What muscles are not under voluntary control?
KatRina [158]

Answer:

I believe the answer is d

4 0
3 years ago
Other questions:
  • In his breeding experiments, how did Mendel know which traits came from which pair of plants?
    8·1 answer
  • A father has dimples, the mother does not have dimples, and all four of their children have dimples. Dimples (D) are dominant ov
    15·1 answer
  • Describe the pathway a sperm cell travels beginning where it forms in the testes?
    11·1 answer
  • In this modern age of science, which of the following shows the most promise in producing crops with a higher yield? )
    6·1 answer
  • Holes drilled several kilometers into earths crust provide direct evidence about earths interior in the front of
    9·1 answer
  • How are scientific question turned into investigation ?
    5·1 answer
  • Name the monomers that make up each of the macromolecules
    12·1 answer
  • Human red blood cells can live from two to four months without a nucleus, and yet they continue to synthesize hemoglobin. This G
    13·1 answer
  • PLEASE HELP! .......................
    6·1 answer
  • List the types of catastrophic events that are most likely to impact our ecosystem here in Cypress, Texas. (that is where i my s
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!