1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kazeer [188]
4 years ago
10

Define nomenclature ​

Biology
1 answer:
ch4aika [34]4 years ago
4 0
Nomenclature is a system of names or terms. for instance- assigning a name to each distinct species <3
You might be interested in
En que unidad de longitud se miden las celulas
Charra [1.4K]

Answer:

La unidad para medir las células es la micra (m ) la cual equivale a la milésima parte de un milímetro (1m = 0,001mm).

Explanation:

3 0
4 years ago
Read 2 more answers
Which factor decreases the rate of a chemical reaction
weeeeeb [17]
Factors that influence the reaction rates of chemical reactions include theconcentration<span> of reactants, </span>temperature<span>, the physical state of reactants and their dispersion, the solvent, and the presence of a catalyst</span>
5 0
4 years ago
Read 2 more answers
Independent variable
Nataly_w [17]
The independent variable is Time (months) 
4 0
3 years ago
Q: Melting point is and example of a physical property of matter <br><br> TRUE OR FALSE
maxonik [38]
This answer is true.


The reason it’s true is because examples of physical properties include density, color, hardness, melting and boiling points, and electrical conductivity.
4 0
3 years ago
Which will make a population have more genetic variation apex?
Vikentia [17]
I believe mutation will make a population have more genetic variation. Genetic variation describes naturally occurring genetic differences among individuals of the same species. It is the difference in DNA sequences between individuals within a population. Variation permits flexibility and survival of a population in the face of changing environmental circumstances. It is considered an advantage, as it is a form of preparation for the unexpected. 
3 0
3 years ago
Read 2 more answers
Other questions:
  • Messenger RNA travels from the _________ to the __________ delivering information from a strand of DNA.
    5·2 answers
  • A red flower and a white flower produce pink offspring. What condition explains this phenomenon? incomplete dominance multiple a
    10·2 answers
  • Agrobacterium A. contain the Ti plasmid which modifies the growth of plant tissue.B. produce antibiotics.C. infect animal cells.
    8·1 answer
  • Despite its name, the Pacific sea horse is actually a type of fish. Its horse-shaped head giv its name. This creature lives in t
    7·2 answers
  • 2 cm
    14·1 answer
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • The Trans-Pecos ecoregion in the western portion of Texas
    15·1 answer
  • When basaltic lava flows in channels or lava tubes it can move up to 30 km/hr (19 mi/hr). How would this type of flow affect the
    12·1 answer
  • Expliquer pourquoi les coraux blanchissent
    12·1 answer
  • How does the muscular system help humans maintain posture? Muscles continually align themselves vertically to help maintain post
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!