1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
3 years ago
9

- Higher Order Thinking Nicole, Tasha,

Biology
1 answer:
musickatia [10]3 years ago
3 0

Answer:

Joan Walks \frac{7}{12}miles farther than maria

Explanation:

Given:

Distance walked by Nicole = 1. 11/12 miles

Distance walked by Tasha= 2. 1/12 miles

Distance walked by Maria = 1. 7 /12 miles

Distance walked by Joan = 2. 2/12 miles

To find:

How much farther Joan walks to school  than Maria = ?​

Solution:

We can find the distance that Joan walk more than maria by subtraction

Joan distance -  maria distance

here the distance are given in mixed fraction , so lets covert them into fraction and perform subtraction

=> 2\frac{2}{12} - 1 \frac{7}{12}

=>\frac{24+ 2}{12} -  \frac{12 +7}{12}

=>\frac{26}{12} -  \frac{19}{12}

=>\frac{26 - 19}{12}

=>\frac{7}{12}

You might be interested in
List three fossil fuels. How are they different from each other?<br> Will Give Brainliest
Anna [14]
Coal, Natural Gas, and Putroleeum?oil
7 0
3 years ago
Read 2 more answers
All of the following patterns were witnessed by Darwin except that species vary
Aleksandr [31]
<span>The only incorrect answer is d. within very short spans of time.<span>

<span>In his Theory of Evolution, Darwin noted three patterns of biodiversity:</span>
<span>1. Species vary globally - different, but ecologically similar animal species inhabit separate habitats around the Globe, but again, these habitats are ecologically similar.</span>
2. Species vary locally - different animal species that are related to each other, may occupy different habitats in an area not so far away.
<span>3. Species vary over time - some traits become more common, other less common.


</span></span></span>
7 0
3 years ago
Where the chromosomes are condensing. Metaphase Prophase Telophase
Zarrin [17]
I am pretty sure that it is in the prophase
4 0
3 years ago
What are stem cells, and why might a person with damage to the brain or spinal cord be very interested in the advancement of thi
KATRIN_1 [288]
Stem cells: Undifferntiated cells with the ability to differentiate (another word for develop/change) into other cells with specialized purposes such as nerve cells.

Someone with neurological damage could benefit as they have received nerve damage; if stem cells could differentiate into nerve cells that could be transplanted into that someone without their body rejecting it, the neurological damage could be reduced.

One ethical implication is that stem cells could be harvested from zygotes.
6 0
4 years ago
Classification is an important aspect of understanding and describing the many life forms on earth. In their classification sche
BARSIC [14]

Answer:

the broadest is domain ,kingdom ,phylum, class, order, family, genus and then species is the most specific

3 0
4 years ago
Other questions:
  • A tall (dominant trait) pea plant is crossed with a short (recessive trait) pea plant to determine if the tall pea plant carries
    15·1 answer
  • What are PCB’s and where in the body do Tomcods store PCB chemicals?
    7·1 answer
  • Identify the structure of the human heart that rises from the pulmonary trunk, connects to the left lung, and conveys venous blo
    9·2 answers
  • Identify the type of graph shown by the population growth of a species that recently entered a new habitat and is becoming invas
    5·1 answer
  • The answer to this because I have no clue
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Many scientists are begging for governments and people to create sanctuaries
    12·1 answer
  • Sense helps in translating outside information in understanding
    12·1 answer
  • What countries has 2 or more geothermal power plants?
    14·1 answer
  • Australian dragon lizards have a ZW sex-determination system. The male genotype is homogametic (ZZ), and the female genotype is
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!