" the thousand injuries of fortunato i had borne as i best could, but when he ventured upon insult i vowed revenge.
hope it helps
Answer:
I feel like this answer is mostly personal preference, but if it were me I would most likely choose B- Will Buck encounter more violence.
Explanation:
Good Luck!
During those first months the Shimerdas never went to town. Krajiek encouraged them in the belief that in Black Hawk they would somehow be mysteriously separated from their money.
Answer:
By applying Chargaff's rule, which states that A only bonds with T and C only bonds with G in a DNA strand. One other factor that makes the rule true is because of the presence of hydrogen. Hydrogen ensure the bonding between the bases which holds the DNA Strands together.
Explanation:
By Applying Complementary Base-Pairing Rules, Let's say you have a DNA sequence of a specific gene on one strand of DNA. You can then use complementary base pairing rules to figure out the other DNA strand that makes up the DNA molecule. For example, let's say you have the following sequence:
AAGGGGTGACTCTAGTTTAATATA
You know that A and T are complements of each other and C and G are complements of each other. That means the DNA strand that pairs with the one above is:
TTCCCCACTGAGATCAAATTATAT
Use the rule and example and fill in the table.
Answer:
The second sentence (And I hereby enjoin upon the people so declared to be free to abstain from all violence, unless in necessary self-defense; and I recommend to them that, in all case when allowed, they labor faithfully for reasonable wages.
.)
Explanation:
This sentence, specifically pointing at the phrase "abstain from all violence..." and "they labor faithfully for reasonable wages" implies that Lincoln does not wish to infringe on the rights of former slaves but wishes to clarify that he does not condone violence against former masters but supports freedman work as long as it is with "reasonable wages"
I hope that this helps you!!!