1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady_Fox [76]
3 years ago
13

One way to reduce global pollution would be to__

Biology
2 answers:
g100num [7]3 years ago
7 0

Answer:

Using cars less

Explanation: Use less gas can make less pollution.

lesya692 [45]3 years ago
6 0

Answer:

speak up

Explanation:

You might be interested in
An experiment is designed so that you can observe the differences between the experimental group and the 
brilliants [131]

Answer:

Control group

Explanation

In every experiment, we must need a standard or control to compere the other variations or treatments we assay. For example, we want to know the effect of a new fertilizer in plants. We have one group of plants without fertilizer and one group with fertilizer. after a month we see if the fertilizer is effective in promoting growth, we compare the size of the plants with and without if it is effective the plant will be taller than control group.

5 0
3 years ago
Read 2 more answers
Newborn human babies with lesser body weight are prone to infections. Heavier babies are difficult to deliver through the narrow
Anna11 [10]
It is a kind of Disruptive selection...

7 0
4 years ago
When two organisms evolve in response to the other.
AysviL [449]

Answer:

Coevolution

Explanation:

When two or more organisms each evolve in response to each other, we call it coevolution.

4 0
3 years ago
What does the acronym MBOs stand for? What cell type are they present in?
wel

Answer:

Explanation:

Membrane bound organelles and eukaryotic

4 0
4 years ago
I need help with this question about meiosis
kicyunya [14]
1. sexually
2. 4
3. egg
4. sperm
5. fertilization
7 0
3 years ago
Other questions:
  • What 2 macromolecules make up a cell membrane? What macromolecules are cells mainly made up of?
    11·1 answer
  • After injury to the _______ region of the brain, a person could present as being either unmotivated, passive, and with limited i
    14·1 answer
  • A green pea plant (Gg)is crossed with a yellow pea plant (gg), what is the phenotype and the genotype
    9·2 answers
  • During lung inflation Multiple Choice surfactant is found in the pleural cavity. the lungs cling to the internal surface of the
    5·1 answer
  • The principle of _____ suggests that a plant with the genotype Tt will display a tall phenotype.
    8·2 answers
  • Why does the energy decrease as the trophic level ...
    10·1 answer
  • According to the passage on the left, why were many homesteaders forced to abandon their claims?
    10·2 answers
  • Mom<br> eB<br> eb<br> Ebl EEBb<br> EEbb<br> EeBb<br> Eebb<br> eb<br> EBeb<br> Ebeb<br> Beeb<br> eebb
    9·1 answer
  • Help me PLEASE! Choose one answer! First one to answer get Brainliest!
    10·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!