1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
14

Choose some of these examples to create a system. Explain how the flow of matter and energy occurs in the system.

Biology
1 answer:
ycow [4]3 years ago
3 0

The major difference between the flow of matter and of energy is that the flow of matter occurs in a cyclic manner i.e. it is recycled, however, the flow of energy in an ecosystem is unidirectional which means, it is not recycled. The flow of matter follows the following path

1) Decomposers release nutrients when they break down dead organisms

2) The nutrients are taken up by plants through their roots

3) The nutrients pass to primary consumers when they eat the plants

4) The nutrients pass to higher-level consumers when they eat lower-level consumers

5) When living things die, the cycle repeats

In case of flow of energy, the energy flows through an ecosystem in one direction, from photosynthetic organisms to herbivores to omnivores and carnivores and decomposers, less and less energy becomes available to support life. This loss of usable energy occurs because each energy transfer results in the dissipation of some energy into the environment as heat

You might be interested in
The human genome project is dedicated to the sequencing of the human genetic code. Some people are opposed to sequencing the gen
Alborosie
Mapping the human genome will allow us to locate the genes which are affected during the transmission and occurrence of genetic diseases such as cystic fibrosis. This will help those suffering from these debilitating conditions to be treated better, or to prevent the disease altogether.
7 0
3 years ago
Read 2 more answers
In an experiment, a certain colony of bacteria initially has a population of 50,000. A reading is taken every 2 hours, and at th
Iteru [2.4K]

Answer:

1) Recursive definition: p_n = (50,000)3^n

2) At the beginning of the 4th interval

Explanation:

1)

The initial population of the bacteria at time zero is

p_0 = 50,000

Here we are told that the reading is taken every two hours; we call this time interval "n", so

n=2 h

And also, after every time interval n, the number of bacteria has tripled.

This means that when n = 1,

p_1 = 3 p_0

And when n=2,

p_2 = 3 p_1 = 3(3p_0)=9 p_0

Applied recursively, we get

p_n = 3^n p_0

And substituting p0,

p_n = (50,000)3^n (1)

2)

Here we want to find at the beginning of which interval there are

p=1,350,000

bacteria.

This means that we can rewrite eq.(1) as

1,350,000=(50,000)3^n

By simplifying,

27=3^n

Which means that

n=3

However, this means that the number of bacteria is 1,350,000 after 3 time intervals; therefore, at the beginning of the 4th interval.

8 0
3 years ago
help me plz Which statement best explains why cells were observed in more detail using a compound microscope than a simple micro
Gnoma [55]

Answer:

Which statement best explains why cells were observed in more detail using a compound microscope than a simple microscope?

A compound microscope has greater magnification ability than a simple microscope.

Explanation:

Hope this <em><u>Helped!</u></em> :D

8 0
3 years ago
Name three organelles or structures found in plant cells but NOT in animal cells. Group of answer choices nucleus chloroplast mi
BARSIC [14]

Answer:

Cell wall, chloroplast, and central vacuole

Explanation:

Cell wall, chloroplast, and central vacuole are present in a plant cell but not in the animal cell.

Nucleus, cell membrane, and cytoplasm present in both plant and animal cells.

6 0
2 years ago
At the beginning every heartbeat the heart is what?
PSYCHO15rus [73]

Answer:

The heart is a pump, usually beating about 60 to 100 times per minute. With each heartbeat, the heart sends blood throughout our bodies, carrying oxygen ... It sends out an electrical signal to start the contracting (pumping) of the heart muscle.

Explanation:

6 0
3 years ago
Other questions:
  • What relationship exists between nutrients and biomolecules?
    5·2 answers
  • Which of the following is not one of the unusual characteristics related to the ancient site of Catalhoyuk__________.A. There we
    7·1 answer
  • What type of cell is prepared to live on its own?
    8·2 answers
  • An 18-year-old adolescent who was diagnosed with new-onset type 1 diabetes mellitus has stress and reports not having a menstrua
    14·1 answer
  • Based on electronegativities, which bond of the following bonds is the most polar and which is the least polar? H—F, H—N, H—C, H
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Carbohydrates and fats both...?
    11·1 answer
  • CH3-o-CH _CH3<br><img src="https://tex.z-dn.net/?f=c" id="TexFormula1" title="c" alt="c" align="absmiddle" class="latex-formula"
    6·1 answer
  • Selective breeding occurs quickly.<br> A. True<br> B. False
    11·1 answer
  • Someone help and answer. Cellular respiration and photosynthesis are related because
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!