1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivanshal [37]
3 years ago
6

Which advancement in technology has helped cut down on waste?

Biology
2 answers:
Lisa [10]3 years ago
6 0

Answer:

The best advancement in technology that helped cut down on waste was Email. It revolutionized the world in a way that meant less paper was going to be wasted.

Explanation:

zzz [600]3 years ago
4 0

The writing materials,the envelopes and the stamps are all made of paper and this led to a great waste as the papers have to be disposed after use. This is not the case with electronic mails. Electronic mails do not need paper at all and it has drastically reduce the amount of papers that is used in writing letters.

I hope this helps :)

You might be interested in
One way to reduce the shortage of food for a growing population would be
SpyIntel [72]

The most obvious way to reduce the shortage of food is to reduce population which seems like a long term effort however science has enables us to develop certain ways that could be used to reduce the shortage of food. We are familiar with the term genetically modified plants and animals.  

This technique has enabled us to produce plants and animals of our choice at a faster rate than normal.  

With the help of this we can put desirable traits in organisms.


3 0
3 years ago
Name the pituitary hormones that have other endocrine glands as their target organs (include the hormone's abbreviation). Additi
Step2247 [10]
Here you go i hope this helps

8 0
3 years ago
An organism that must consume other organisms for energy is a
Nikitich [7]

Answer:

A consumer of energy

Explanation:

5 0
3 years ago
Individual cells are usually very small because...?
Rama09 [41]
Because the people that mae them wanted them to be very small

4 0
3 years ago
Read 2 more answers
Select all that apply
Mekhanik [1.2K]
The answer is, "Lithosphere plate boundaries."

Most earth quakes occur in the upper 10-12 miles of the earth crust as the result of failure on faults caused by the strains induced by plate motions.

I hope this helps!
8 0
3 years ago
Read 2 more answers
Other questions:
  • Tim has suffered a vasovagal loss of consciousness, commonly known as fainting. environmental triggers, including the smell of t
    7·1 answer
  • Baby paolo smiles and coos so often and is so delightful that his parents feel compelled to smile and chatter right back at him.
    12·1 answer
  • Which of the following is a necessary trait of a good hypothesis?
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which process allows a mammal to continue to grow in size
    15·1 answer
  • Which of the following is a true statement about weather and climate maps
    13·1 answer
  • Claim stating what the translated sequence from the DNA sequence is
    8·1 answer
  • What is the structures of carbohydrates?
    11·1 answer
  • The virus attacks T cells, which coordinate the<br> response
    11·1 answer
  • Can u answer the quest
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!