Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
D) Asexual reproduction produces offspring that are genetically identical to the parent.
Explanation:
I am honestly not quite sure of this answer, but I was trying to read up on the topic and this is the answer I'm most confident in. It would make sense that the offspring are genetically identical to the parent because they would have no where else to get their genes/mix to form new ones. I really hope this helps!
Fragmentation
the worms break apart and each part grows a new head or tail by regeneration.
Answer:
aquino
tinulungan nya dahil naawa sya
