1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
5

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

Biology
2 answers:
GalinKa [24]3 years ago
8 0

Answer:

This is so he can get brainliest

Explanation:

Hatshy [7]3 years ago
4 0

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

You might be interested in
Which of these examples does NOT depend on the population size of organisms living in an area (density-independent)?
xxMikexx [17]
The effect of chemical pollution on insects living in a pond i think
7 0
3 years ago
Many fruits contain specialized structures that are adaptations for
Anit [1.1K]
Many fruits contain specialized structures that are adaptations for The answer is D. aiding in seed dispersal.
Maple trees have fruits with "Wings" that help the gale disperse the seeds. Some flowering plants grow fleshy fruit that benefits disperse their seeds. When animals eat the fruit, the seeds pass through an animal's digestive tract undamaged.
8 0
3 years ago
What two tissues are found within a vein?
inessss [21]
The tissues found within the vein if I must say are xylem and phloem. Glad I can help.
7 0
3 years ago
ASAP PLEASE At what stage do scientists ask questions and try to explain observations?
lesya692 [45]

The stage that scientists begin to ask questions and attempt to explain observations is A. forming hypotheses. This is because a hypothesis is basically a testable question about observations scientists make.

6 0
2 years ago
In the reaction B + KL + H, if an additional B is added, the result will be _____.
nalin [4]
The question is not clear
6 0
3 years ago
Other questions:
  • Which term best describes the difference in colors of the birds below?
    5·2 answers
  • Summarize how psychology is a science
    11·1 answer
  • Which is a result of a seasonal change (meaning a change that happens over and over at a certain time of a year)?
    14·2 answers
  • The Polymerase Chain Reaction (PCR) is one of the most commonly used techniques in the field of molecular biology and biotechnol
    6·1 answer
  • Which of the following organs is not part of the excretory system?
    7·2 answers
  • What geologic forces shaped Michigan?
    7·1 answer
  • What will happen if you plant a bean seed upside down?
    5·1 answer
  • What animal eats meat?<br>A)chicken<br>B)sheep<br>c)cow<br>D)rabbit
    10·2 answers
  • Which of the following gases is formed during photosynthesis?
    9·1 answer
  • Why the answer for question 2 is D please give detail explanation and example​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!