1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
5

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

Biology
2 answers:
GalinKa [24]3 years ago
8 0

Answer:

This is so he can get brainliest

Explanation:

Hatshy [7]3 years ago
4 0

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

You might be interested in
Why does Red transfer all its momentum to Green?
Archy [21]
<h2>Answer with Explanation </h2>

I have been as of late pondering, on the off chance that I take a sufficiently incredible vitality source (photon) and I have an ideal mirror precisely before it and expect a "producer" shot the light towards the mirror. As impeccable mirrors assimilate no vitality of ANY sort from photons, should this imply the ideal mirrors could never move because of exchange of force of the light? it depends on the mass of the mirror, obviously. Your ideal mirror would have a vast mass, in which case it could assimilate the force change, without engrossing any vitality. A reflection of limited mass will ingest some vitality in a crash that will change the vitality and along these lines the wavelength of the photon. There is no logical inconsistency here.


4 0
3 years ago
Which of the following structures is only a part of male reproductive system in human?
mario62 [17]
Seminiferous tubles is the only part of a male reproductive system
7 0
3 years ago
A diagram of the digestive system is shown below.
Ostrovityanka [42]

Answer: A. To break down food into nutrients that can be circulated around the body. :)

4 0
3 years ago
A nucleotide is a what
Nat2105 [25]

 compound consisting of a nucleoside linked to a phosphate group. Nucleotides form the basic structural unit of nucleic acids such as DNA.


4 0
3 years ago
Read 2 more answers
What term describes an individual possessing two of the same alleles at a gene locus? monohybrid dihybrid homozygous wild type h
Ivahew [28]

Question was't arranged i have arranged it in  ask for detail section.

Answer:

Option e. homozygous is the correct answer.

Explanation:

A gene which has two identical alleles on homologous chromosomes is called homozygous. It is denoted by XX (capital letters)  for dominant character (alleles) and  xx (lowercase letters) for recessive character (alleles).

5 0
3 years ago
Read 2 more answers
Other questions:
  • Identify the part of the mandible that serves as a site of attachment for the temporalis muscle.
    6·1 answer
  • In the lysogenic cycle _____. host dna is destroyed and viral dna is replicated a bacterium replicates without passing viral dna
    15·1 answer
  • What are the most common plants on Earth?
    15·2 answers
  • Which of the following were or soon became a challenge for survival of the first land plants? 1) sources of water 2) sperm trans
    6·1 answer
  • Science photosynthies
    11·1 answer
  • What are some real-life examples of when you want to keep heat energy from being lost to the environment?
    10·2 answers
  • Why are arteries thick walled while veins are thick walled
    11·2 answers
  • (PLESE HELP ME) If a force of 20.0 N is used to lift a box a distance of 0.5 m, how much work is done? (INCLUDE THE UNIT for wor
    5·2 answers
  • Biotic components of an ecosystem are alive.<br> -True<br> -False
    15·2 answers
  • Which statements best describe shared characteristics? Select two options.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!