1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
5

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

Biology
2 answers:
GalinKa [24]3 years ago
8 0

Answer:

This is so he can get brainliest

Explanation:

Hatshy [7]3 years ago
4 0

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

You might be interested in
The four types of nitrogen bases of DNA nucleotides are <br> , <br> , guanine, and cytosine.
gogolik [260]

Answer:

adenine (A), thymine (T), cytosine (C), and guanine (G).

Explanation:

I took 6 years of a biomedical academy

6 0
3 years ago
Read 2 more answers
The amount of movement permitted by a particular joint is the basis for the functional classification of that joint. The amount
levacccp [35]

Answer:

The correct answer will be- true

Explanation:

In Human skeletal system, the point at which the two bones meet is known as the joint which is responsible for the stability of the body and the movement.

The joints can be classified on the basis of their structures and the functions (amount of movement).  

On the basis of movement, the bones are classified into  

1. Synarthroses (immovable joints)- the joints which do not move like sutures.

2. Amphiarthroses (slight movement)- the joints which slightly moves like symphyses

3. Diarthroses (free movement)- the joints which freely moves like synovial joints.

Thus, true is the correct answer.

7 0
4 years ago
Why do living things need water food and ability to get rid of waste
german
To maintain homeostasis
4 0
4 years ago
Read 2 more answers
Which best describes the function of olfactory cilia?
inysia [295]

Answer:

Olfactory Cilia are located along the upper surface of the inside of the nasal passages. These hair-like receptor cells respond to chemical stimuli that have dissolved in the nasal mucus. Olfactory cilia are constantly replaced, an ability not characteristic of the oth er sensory receptors.

Explanation:

6 0
2 years ago
what are the connections between various landforms that shaped on earth's surfaces and processes that are responsible for their
Lena [83]
<span>Identify various land forms (e.g. dunes, lakes, sinkholes, aquifers) and describe how they form (erosion, physical/chemical weathering, and deposition). Explain how sea level changes over time have exposed and inundated continental shelves, created and destroyed inland seas, and shaped the surface of the Earth.</span><span />
8 0
4 years ago
Other questions:
  • Which of the following is something that probably would NOT be studied in a lab?
    7·2 answers
  • Conservation strategies that set aside ecosystems for preservation: question 11 options: are the best way to preserve an area's
    6·1 answer
  • What type of angle is formed by the baseball players leg ? Right, acute, obtuse, or straight
    11·2 answers
  • Where in the DNA molecule does hydrogen bonding occur?
    6·1 answer
  • The genetic information contained in DNA consists of a linear sequence of coding units, known as codons. Each codon consists of
    9·1 answer
  • A yellow pea plant (Yy) and a green pea plant (yy) could not produce green offspring. true or false?
    11·2 answers
  • 1. Identify what type of rock belongs in #2
    14·1 answer
  • The notochord is an embryonic structure in humans that develops into
    13·1 answer
  • How does the amount of light affect how plants grow?
    10·1 answer
  • 5. Thinking Critically Paramecium, a single-celled fresh-water organism,
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!