1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
5

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

Biology
2 answers:
GalinKa [24]3 years ago
8 0

Answer:

This is so he can get brainliest

Explanation:

Hatshy [7]3 years ago
4 0

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

You might be interested in
What are earthquakes?
hichkok12 [17]
An earthquake is the perceptible shaking of the surface of the Earth, resulting from the sudden release of energy in the Earth's crust that creates seismic waves.
5 0
3 years ago
Explain how the structure of an enzyme makes that enzyme specific
kotykmax [81]
Hello. this is very simple. i know it and im in middle school. dont highschoolers know that you can just ask google and get a verified answer in just a few seconds?

sighs, well i guess older kids dont get technology as much as we do.

no offense, but seriously if you pay more attention in class you might not be asking this silly question right now.




Molecule which enzyme<span> acts on = the substrate. 5. Substrate molecule is held within the active site by bonds that temporarily form between certain amino acids of the active site and groups on the substrate molecule. ... This folds in a particular way = each </span>enzyme<span> has a </span>specific<span> tertiary </span>structure<span>.</span>

6 0
3 years ago
The vatican archives maintain a vault where century's worth of old documents are stored in very high n2 levels to prevent oxidat
Vinil7 [7]

The Vatican archives stores multiple precious documents and books of the world. These old documents dating hundred of years are kept in high nitrogen levels, in order to prevent the oxidation of the paper (papyrus). The presence of the high level of inert nitrogen in the air in the archives prevents any kind of damage that may caused to the paper or the ink on those documents. This high level of nitrogen, however, may affect the health of the individual by decreasing the oxygen levels in the body.

Hence, the answer is 'the oxygen level will be decreased in the body'.

7 0
3 years ago
What part does chlorophyll play in photosynthesis?
lara [203]

Answer:

it captures the sun's energy

5 0
3 years ago
Read 2 more answers
·caused by a virus ·Edward Jenner developed a vaccine ·considered to be a biological weapon ·declared disease eradicated in 1980
stiv31 [10]
The correct answer choice is D, smallpox.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Secondary succession would most likely be taking place in a(n)
    8·2 answers
  • Definition of cytoplasm
    15·2 answers
  • What is the vocabulary word for a section of dna that codes for a specific protein?
    11·1 answer
  • Carbohydrates are the primary source of energy for the human body. If your body lacks enzymes that break down carbohydrates, it
    14·2 answers
  • A hole in the heart is actually an opening in the wall dividing the left and right sides of the heart. This wall is called the s
    7·1 answer
  • What happens to an enzyme's structure as it<br> exceeds the typical human body temperature?
    15·1 answer
  • Alleles from different genes usually ______ independently from each other when gametes form
    8·1 answer
  • The human genome comprises just over 3.1 billion base pairs. Assuming average nucleosome spacing throughout the genome, how many
    8·1 answer
  • What are two examples of decomposers that break down animal skin?
    9·1 answer
  • Find an article on a current issue in forestry, and summarize it for the class. Provide a link to the article. What is your opin
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!