1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
5

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

Biology
2 answers:
GalinKa [24]3 years ago
8 0

Answer:

This is so he can get brainliest

Explanation:

Hatshy [7]3 years ago
4 0

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

You might be interested in
Which is the main function of fruit?
DaniilM [7]
To give vitmains and minerals to humans and other creatures
6 0
3 years ago
Number of chromosomes?
DerKrebs [107]
<h2>Hey There!</h2><h2>_____________________________________</h2><h2>Answer:</h2><h2>KAROTYPE:</h2>

This is the picture of karyotype. Karyotype is a collection of a Individuals chromosome. Like pairs are separately represented from the unlike pairs, It is generally used to study the chromosomes and the abnormalities found in the number of chromosomes.

<h2>_____________________________________</h2><h2>CHROMOSOMAL NUMBER 18:</h2>

Every chromosomal pair seems fine, except the chromosomal pair number 18. Because as you ca see that it has 3 chromosomes instead of 2. This impairment in the chromosomal pair is called trisomy as it has 3 chromosomes.

<h2>_____________________________________</h2><h3>TRISOMY 18:</h3>

Trisomy 18 is also called Edwards syndrome. It is a chromosomal condition associated with abnormalities in more than one part of the body. Individuals with trisomy 18 often mature slowly than normal fetus before birth and they have lower weight at the time of birth as compared to the other children.

<h2>_____________________________________</h2><h2>Best Regards!</h2><h2>'Borz'</h2>

4 0
3 years ago
Ali Kashif, a recent immigrant, is admitted for continued treatment of CHF. During the assessment, he reveals that he has been u
sweet-ann [11.9K]

Answer: No, there is no cause for concern because amrinone is the same as Inocor

Explanation:

The trade name for amrinone is inocor which helps improve the prognosis in patients with congestive heart failure (CHF)

Digoxin is used to maintain clinical stability and improve symptoms, quality of life and exercise tolerance in patients with congestive heart failure.

Since he did not respond to treatment with digoxin, diuretics and vasodilators and has decided to take amrinone then there is no cause for alarm since amrinone is the same as inocor

7 0
3 years ago
A main sequence star becomes a ____ after it uses up the hydrogen in its core.
Arisa [49]
A main sequence star becomes a GIANT after it uses up the hydrogen in its core.
A giant star is a star with a large radius and luminosity that is much more greater than that of a main sequence star. A giant star is typically formed when a main sequence star deplete its hydrogen gas content. Giant stars usually correspond to the luminosity class ll and lll.
3 0
3 years ago
I need help pleaseee
Lubov Fominskaja [6]

Answer:

With regard to bone decalcification secondary to hypocalcemia, what an endocrinologist and an orthopedist have in common is that they both focus on calcium levels.

Explanation:

Endocrinology and traumatology are two different medical specialties, however they can together treat a person with a metabolic disorder affecting the bones.

In the case of a person with thyroid problems, where probably the parathyroid glands are affected, there are low levels of calcium in the blood —hypocalcemia— which affects the bones secondarily by decalcification, both the endocrinologist and the traumatologist will coincide in the treatment of the serum calcium levels:

  • <u>Endocrinologist</u> will treat the hormonal problem that produces low calcium in the blood.
  • <u>Orthopedist</u> will indicate a calcium replacement treatment to improve the levels of the mineral in the blood, and restore the calcium lost by the bones.

The joint treatment of both specialists can guarantee the recovery of a patient with problems in the metabolism of calcium.

3 0
3 years ago
Other questions:
  • The new food safety rules proposed by the fda are to completely prevent __________.
    7·1 answer
  • Jeremy is observing a cross-section of a corn stem under the microscope. He observes that there is no vascular cambium present i
    10·2 answers
  • The image above shows particles in a medium. which of the following show the worst conditions for a sound wave to travel in. I d
    5·1 answer
  • A plant reaches its adult stage when _____.
    9·2 answers
  • Which of the following areas would most likely have the greatest amount of surface runoff?
    11·1 answer
  • Describe the benefit of the bilayer structure of the plasma membrane
    5·2 answers
  • The mutations responsible for the dark fur color in the Arizona mice were absent from the three different populations of New Mex
    10·1 answer
  • The table contains errors. Which factors should be switched to correct the errors?
    13·1 answer
  • What part of the bone produces blood cells?
    15·1 answer
  • How do weeds In plants affect the rate of transpiration?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!