1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
5

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

Biology
2 answers:
GalinKa [24]3 years ago
8 0

Answer:

This is so he can get brainliest

Explanation:

Hatshy [7]3 years ago
4 0

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

You might be interested in
A population of dogs can be either brown or black; the black allele (B) has complete dominance over the brown allele (b). Given
Marat540 [252]

Answer:

The frequency of individuals with the dominant phenotype is 0.83.

Explanation:

We are provided with:

Black allele has completed dominance over brown allele

T. no of dogs (dominant)= 2000

No. of black dogs (dominant) = 1660

From Hardy-weinberg equilibrium

Frequency of individual - (individual/ Total population)

Frequency of black dogs = 1660/2000 =

0.83

So, The frequency of individuals with the dominant phenotype is 0.83

4 0
3 years ago
Read 2 more answers
The form of oxygen that combines three oxygen Adams into each molecule is called
Mama L [17]
Hello

The form of oxygen that combines three oxygen atoms into each molecule is called<span>. Poll Everywhere.

Have a nice day</span>
3 0
3 years ago
Read 2 more answers
Circulating throughout the body, adh arrives at the ____________ of the kidneys.
gogolik [260]
<span>Circulating throughout the body, adh arrives at the nephrons of the kidneys, Nephrons are the basic microscopic functioning unit of the kidneys. Our kidneys consist of millions of nephrons.
ADH stands for anti-diuretic hormone and it is also known as vasopressin and  it is secreted by the pituitary gland and it helps the kidney to maintain the water in the body.</span>
6 0
3 years ago
Two stimuli repeatedly experienced together will eventually elicit the same response. Additionally, behaviors followed by pleasa
photoshop1234 [79]

Answer:

Change in behavior due to the experience result.

Explanation:

The organism is able to elicit a response against the particular stimuli. The stimuli can be from the external as well as from the internal environment.

The response against a stimuli can be pleasant as well as can be awarded with the punishment. The stimuli awarded with pleasant can be repeatedly used by the organism and unpleasant outcomes of the stimuli can be completely dropped. The individual changes its behavior due to the experience of the result provided by the stimuli outcome.

8 0
3 years ago
Vascular plants exhibit alternation of generation. What is alternation of generation?
nasty-shy [4]
I think the answer would be A 
5 0
3 years ago
Other questions:
  • If you wrap fresh celery in foil, it will stay crunchy when you store it in the refrigerator. Explain why you think this happens
    10·1 answer
  • The following tracking model was created for Hurricane Ike on September 8, 2008. Map of Gulf Coast showing the forecasted path o
    7·2 answers
  • Which is not one of the top risk factors for many chronic diseases?a. poor nutrition
    10·1 answer
  • ""double effect" refers to a situation in which a beneficial action may have potentially harmful side effects"
    9·2 answers
  • Is the spinal cord part of the peripheral nervous system
    14·1 answer
  • How do aquatic organisms return carbon dioxide? (Photosynthesis, evaporation, or excretion?)
    5·1 answer
  • PLEASE HELP WORTH 20 POINTS WILL MARK BRAINLIEST!!!!!!
    10·1 answer
  • Which of the following is a farming method that helps reduce the effects of wind erosion? A. Planting wind barriers B. Irrigatio
    9·1 answer
  • How could researcher on how genes control traits in orchids benefit our understanding of the human genome
    6·2 answers
  • Term Definition
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!