All categories

3 years ago

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

Biology

2 answers:

GalinKa [24]3 years ago

8 0

Answer:

This is so he can get brainliest

Explanation:

Hatshy [7]3 years ago

4 0

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’

You might be interested in

How are the changes in atmospheric carbon dioxide described? A. Carbon dioxide levels have increased B.carbon dioxide levels can

drek231 [11]

A. Carbon dioxide levels have increased

Hope this helps!

8 0

2 years ago

What is the magnitude of the force exerted by the biceps fbiceps? What is the magnitude of the force exerted by the elbow felbow

Slav-nsk [51]

Answer:

The magnitude of the force exerted by the biceps $f_b_i_c_e_p_s$ is 218.38N

The magnitude of the force exerted by the elbow $f_e_l_b_o_w$ is 194.37N

Explanation:

Firstly , lets calculate the magnitude of force exerted by biceps $f_b_i_c_e_p_s$ -

Mass of the forearm=

$m_f=1.50kg$

Mass of the ball =

$m_b_a_l_l=950g$

= 0.950kg

so, weight of the forearm=

$w_f=m_f$ g

weight of the ball=

$w_b_a_l_l=m_b_a_l_l$ g

Now , balancing torque about the elbow , we have-

$F_b_i_c_e_p_s\times d_b_i_c_e_p_s= w_f\times\frac{d_b_a_l_l}{2} + w_b_a_l_l\times d_b_a_l_l$

(here , distance of the bicep is 2.50cm = 0.025m and distance of the ball is 36cm= 0.36m)

Now putting the given values in the formula -

$F_b_i_c_e_p_s\times 0.025= 0.95\times9.8\times\frac{0.36}{2} +1.50\times 0.36$

$F_b_i_c_e_p_s=218.38N$

Now, lets calculate the force exerted by elbow $F_e_l_b_o_w$ -

Balancing the vertical forces

$F_b_i_c_e_p_s=F_e_l_b_o_w+w_f+w_b_a_l_l$

$F_e_l_b_o_w = 218.38-(1.00\times9.8)-(0.95\times9.8)$

$F_e_l_b_o_w=194.37N$

8 0

2 years ago

Why would you never use “sour taste” to identify a compound as acidic?

bixtya [17]

Because acids have a bitter taste i believe

4 0

2 years ago

Read 2 more answers

How are diffusion and osmosis different? A. Osmosis is the movement of proteins. Diffusion is the movement of water. B. Osmosis

stepladder [879]

The answer is B, osmosis is the movement of water. Diffusion is the movement to chemicals and molecules.

Both osmosis and diffusion are movement of molecules from a region of higher concentration of the substance moving to lower concentration down the concentration gradient. However, osmosis is only for the movement of water molecules, while diffusion is for any type of substances including liquid or gas. So we can also say osmosis is a type of diffusion actually.

And also, both of these movement of molecules does not require extra energy, they all happen due to natural tendency.

6 0

3 years ago

Read 2 more answers

Before atp is split into adp and pi, it holds what type of energy?

maksim [4K]

It intially will be holding chemical energy (used in chemical processes). After it divides into adp and pi they'll be holding kinetic energy.

Hope it helped,

BioTeacher101

3 0

3 years ago