1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kakasveta [241]
4 years ago
8

Which of the following is not a characteristic of anaerobic species?

Biology
2 answers:
Vladimir [108]4 years ago
8 0

Answer:D

Explanation:good guess

pantera1 [17]4 years ago
5 0

Answer:

The correct answer is option D.

Explanation:

Organisms or particularly species that survive in the absence of free oxygen are called anaerobes or anaerobic species. Some of the anaerobes grow only in the absence of free oxygen are called strict or obligate anaerobic species.

Anaerobic species only form 2 molecules of ATP for every 1 molecule of glucose, while aerobic cells produce 38.Fermentation metabolism permits these species to survive in some of the most extreme environments.

Thus, the correct answer is option D.

You might be interested in
Most fad diets focus on restricting certain types of food and nutrients. What do you think would happen if someone ate an extrem
telo118 [61]

Answer:

Eating a diet of low levels of protein could leave you to development a condition called edema, which causes swelling in your legs and feet from the buildup of fluids. Protein plays an essential role in maintaining salt and water inside your blood vessels and ensuring fluid does it make its way into the tissues. Hajima can cause stiffness, difficulty walking, increasingly painful swelling.

Explanation:

4 0
3 years ago
Read 2 more answers
Which tool would you use to predict the percentage of offspring that will have a specific trait?i need help
scoundrel [369]
Punnett square predicts the percentage of offspring
5 0
3 years ago
If anyone can upload a picture of the drawing part before 12am, that be nice!
Minchanka [31]

Answer:

photo is not clear send me

8 0
3 years ago
Please help asap will give extra point
Lorico [155]
I believe the answer is 1500
5 0
4 years ago
Identify the molecule that is produced during cellular respiration to power chemical reactions
Elis [28]

Answer:During the process of glycolysis in cellular respiration, glucose is oxidized to carbon dioxide and water. Energy released during the reaction is captured by the energy-carrying molecule ATP (adenosine triphosphate).

Explanation:

4 0
3 years ago
Other questions:
  • Antoinette was diagnosed with hypertension, a noncommunicable disease in which her blood pressure is higher than normal.
    9·1 answer
  • A scientist tries to mate the two similar-looking fruit flies Drosophila melanogaster and Drosophila simulans. But he finds that
    5·1 answer
  • Is Sirius closer to earth than the sun
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What amino acid in turkey is often blamed for people becoming sleepy
    9·2 answers
  • what are two other things the students should look at before evaluating which container is better for the environment
    6·1 answer
  • According to the passage on the left, why were many homesteaders forced to abandon their claims?
    10·2 answers
  • Give 4 examples of types of specialized cells.
    9·1 answer
  • What is the anammox reaction, and when does it occur in the nitrogen cycle?
    10·1 answer
  • During a procedure called ___, angela's knee pain and joint stress is relieved when her inflamed joint space is punctured with a
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!