This is most definitely the definition for a Lipid!
Answer:
The correct answer would be Option C, Multipurpose Trees.
Explanation:
With the advancement in industries and other areas of technology, the rural areas have become so much polluted. So the sustainability of the rural areas is doubtful. The air in the rural areas have become polluted and needs measures to prevent it from harmful consequences of the industrial advancements. Along with industries, the air pollution is also added through vehicles discharge, waste disposal, etc also contribute towards the non sustainability of the rural areas. So to overcome all these problems, the best solution is to grow the multipurpose trees in the rural areas as much as possible to increase the sustainability of these areas. With the plantation of trees, the problem of pollution will be controlled and thus make these areas sustainable.
Question:why were maggots there only after the flies left
Hypotheses:the maggots are fly larva
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
