1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yan [13]
3 years ago
13

DNA polymerase can only add nucleotides to a free 3(-hydroxyl group on a nucleic acid strand. As a consequence, all EXCEPT which

of the following statements are true of DNA replication?
A) Synthesis of one complementary DNA strand lags behind the synthesis of the other strand.
B) DNA replication requires both DNA polymerase III and DNA polymerase I.
C) Primase must synthesize an RNA primer before DNA synthesis can begin.
D) Uracil is not found in DNA.
Biology
1 answer:
lana66690 [7]3 years ago
4 0

Hey! The answer to your question would be, A. Synthesis of one complementary DNA strand lags behind the synthesis of the other strand. Hope this helps. :-)

You might be interested in
All of the following are macromolecules except:
Harman [31]

Answer:

The correct answer is c. Fatty acids

Explanation:

There are four major types of macromolecules present in nature and that are carbohydrates(polysaccharides), proteins, lipids, and nucleic acids. These macromolecules are polymers and are made up of monomer units.  

The monomeric unit of polysaccharides is mainly glucose, of protein is amino acids, of nucleic acid is nucleotides and the monomeric unit of lipid is fatty acids. Ribosomes are macromolecules because it is made up of RNA  and proteins.

So fatty acid is a monomer which joins together to form large macromolecules like lipids. Fatty acids are made up of a hydrocarbon chain which have one attached COOH group at the terminal position.

Therefore the correct answer is c. Fatty acids.

6 0
3 years ago
How does food provide energy and matter for organisms?​
svlad2 [7]

Answer:

Food provides the molecules that serve as fuel and building material for all organisms. Plants use the energy from light to make sugars from carbon dioxide and water. ... Organisms Explanation:

7 0
2 years ago
Please Help 20 points + thanks and give brainiest answer!Explain the difference between ionic compounds and covalently bonded co
Bogdan [553]
Ionic compounds are formed from strong electrostatic interactions between ions, which result in higher melting points and electrical conductivity compared to covalent compounds. Covalent compounds have bonds where electrons are shared between atoms. 
5 0
2 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
2 years ago
After phagocytosis occurs, enzymes from which organelle can digest what is in the vesicle/vacuole?
mezya [45]

Answer: Phagocytosis and Autophagy

Such large particles are taken up in phagocytic vacuoles (phagosomes), which then fuse with lysosomes, resulting in digestion of their contents.

Explanation: That's what I would say. Hope this helped and i hope you have a beautiful day:]

8 0
2 years ago
Other questions:
  • Directional selection only occurs in response to naturally occurring events.
    5·1 answer
  • In several neurological diseases, axons lose their insulating myelin sheath. what is the consequence of this loss
    6·1 answer
  • Second messengers in signal transduction pathways:
    13·1 answer
  • A red flower and a white flower produce pink offspring. what condition explains this phenomenon?
    12·2 answers
  • Rare genetic disorders may become common in small populations through ____________________. a. rapid environmental change c. gen
    8·1 answer
  • Let’s assume that dragons show incomplete dominance for fire breathing. The F allele provides lots of fire and the F’ allele giv
    9·1 answer
  • Mammalian eyes sense light because the photoreceptor cells have molecules called opsins, which change structure when exposed to
    9·1 answer
  • What is the name given to the rivers of the water that run through all depths of the ocean
    8·2 answers
  • Which units can be used to measure length or distance? Check all that apply.
    14·1 answer
  • How long is the auditory canal​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!