Answer:
The correct answer is c. Fatty acids
Explanation:
There are four major types of macromolecules present in nature and that are carbohydrates(polysaccharides), proteins, lipids, and nucleic acids. These macromolecules are polymers and are made up of monomer units.
The monomeric unit of polysaccharides is mainly glucose, of protein is amino acids, of nucleic acid is nucleotides and the monomeric unit of lipid is fatty acids. Ribosomes are macromolecules because it is made up of RNA and proteins.
So fatty acid is a monomer which joins together to form large macromolecules like lipids. Fatty acids are made up of a hydrocarbon chain which have one attached COOH group at the terminal position.
Therefore the correct answer is c. Fatty acids.
Answer:
Food provides the molecules that serve as fuel and building material for all organisms. Plants use the energy from light to make sugars from carbon dioxide and water. ... Organisms Explanation:
Ionic compounds are formed from strong electrostatic interactions between ions, which result in higher melting points and electrical conductivity compared to covalent compounds. Covalent compounds have bonds where electrons are shared between atoms.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer: Phagocytosis and Autophagy
Such large particles are taken up in phagocytic vacuoles (phagosomes), which then fuse with lysosomes, resulting in digestion of their contents.
Explanation: That's what I would say. Hope this helped and i hope you have a beautiful day:]