Answer:
The correct answer is b. actors have to be more likely to carry the altruistic allele than non actors.
Explanation:
Altruism is the behavior by an organism that benefits other organisms by costing its own fitness. The actor is the individual who is doing altruism and the recipient is the individual who is getting benefited by the actor's altruism.
An example of altruistic behavior can be seen in animal kingdom easily. Vampire bats give blood to those members of the community who were not able to go for search for blood show altruistic behavior.
Actors have altruistic genes that suggest them to behave altruistically. Non-actors may not contain alleles of altruism but the recipient might have altruistic alleles.
Hamilton's rule says that natural selection will favor the altruistic allele when rb > c.
where r = coefficient of relatedness between donor and recipient
b = benefit received by recipient and
c = cost paid by altruist.
Therefore, the correct answer is b.
Answer:
b. 10% of the plant's energy.
Explanation:
In an ecosystem, there are various trophic levels, which form the part of the food chain. Producer like plants forms the first trophic level as they synthesize their own food via photosynthesis.
Hope it helps! ^_^
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
