1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DanielleElmas [232]
3 years ago
7

Name an organelle that you see in the plant cell that you did not see in the animal cell.

Biology
2 answers:
vagabundo [1.1K]3 years ago
8 0
Organelles that you see in plant cells only include:

Vacuole

Chloroplast

Cell wall
lina2011 [118]3 years ago
5 0
Chloroplast and cell wall 
Hope it helps
You might be interested in
Rhizobium bacteria obtain moisture from: A.protiens B.nodules c.legumes D.air
ankoles [38]
The correct answer is letter D, air. This is a type of bacteria that is often found in soil. Its culture is highly dependent on the moisture that develops on the ground. The water cycle provides such opportunity for these bacteria to grow in moist conditions. The evaporation and condensation of water that occurs within the atmosphere of the Earth gives these bacteria the ability to thrive.
4 0
3 years ago
Read 2 more answers
Describe the type of information a 3D image provides that a 2D does not ?
Arlecino [84]

Answer: more definition

Explanation: the 3D image has more definition or details it also provides a feeling of reality where as a 2D image does not (try and put this in your own words when you type this so you don't get caught)

3 0
2 years ago
10. Which is(are) correct regarding DNA?
nata0808 [166]

Answer: D - all of the above

Explanation:

Cytosine (C) is paired with Guanine (G) according to the base pair rule just as Adenine (A) is paired with Thymine (T).

The sugar in DNA is deoxyribose which is a modified form of ribose(also sugar). It simply is a ribose sugar which has lost an oxygen atom hence “deoxyribose”. Deoxyribose is one of the components that make up the DNA backbone.

Hydrogen bonds exist between bases. The importance of these hydrogen bonds is to hold the complementary strands of DNA together.

3 0
2 years ago
What is a possible benefit of studying plants in the rainforest? 1) The Plants may hold medicines to treat human diseases - 2) T
elixir [45]

Answer: The plants may produce needed carbon dioxide.

Explanation:

This is the only benefit as medicine needs to be found, they won't be cut down, and they do take in toxins but it does not affect the study

5 0
2 years ago
PLEASE HELP ONE QUESTION
Bezzdna [24]
B
hope this helped you
7 0
2 years ago
Other questions:
  • What is any energy resource that can be used in place of fossil fuel’s called
    15·2 answers
  • The leaves of trees appear green because chlorophyll light
    15·1 answer
  • How might an ecologist analyze how an increase in the population size of copperheads would affect the rest of the ecosystem?
    15·2 answers
  • when you sweat a lot the water content of your blood can drop. your cells have to maintain a certain level of water and salt in
    12·1 answer
  • SNPs contain: A) variable amino acid substitutions and are highly heterogeneous. B) various nucleotides transcribed repeatedly a
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • A niche is part of an organism's habitat.<br><br> True or False?
    8·2 answers
  • All BUT one of the conditions will increase the reaction rate of an enzyme. The condition that will NOT increase the reaction ra
    11·2 answers
  • A pathogenic RNA molecule is called a...<br> capsid<br> Virion<br> Virold<br> prion
    15·1 answer
  • How could the changes made to the amino acid sequence influence phenotype changes?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!